This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Zwaka, T. P. Articles by Torzewski, J. Search for Related Content PubMed PubMed Citation Articles by Zwaka, T. P. Articles by Torzewski, J. Related Collections Lipids Pathophysiology

(Circulation. 2001;103:1194.)
© 2001 American Heart Association, Inc.

Brief Rapid Communications

C-Reactive Protein–Mediated Low Density Lipoprotein Uptake by Macrophages

Implications for Atherosclerosis

Thomas P. Zwaka, MD; Vinzenz Hombach, MD; Jan Torzewski, MD

From Internal Medicine II–Cardiology, University of Ulm, Ulm, Germany.

Correspondence to Jan Torzewski, MD, MPhil, Internal Medicine II, Cardiology, University of Ulm, Robert Koch-Str 8, 89081 Ulm, Germany. E-mail jan.torzewski{at}medizin.uni-ulm.de

	Abstract

Top Abstract Introduction Methods Results Discussion References

 
Background—LDL and C-reactive protein (CRP) are important cardiovascular risk factors. Both LDL and CRP deposit in the arterial wall during atherogenesis. Stranded LDL is taken up by macrophages, causing foam cell formation. Because native LDL does not induce foam cell formation, we hypothesized that CRP may opsonize native LDL for macrophages.

Methods and Results—Monocytes were isolated from human blood and transformed into macrophages. CRP/LDL uptake was assessed by immunofluorescent labeling and the use of confocal laser scanning microscopy. Native LDL coincubated with CRP was taken up by macrophages by macropinocytosis. Uptake of the CRP/LDL coincubate was mediated by the CRP receptor CD32.

Conclusions—We conclude that foam cell formation in human atherogenesis may be caused in part by uptake of CRP-opsonized native LDL.

Key Words: lipids • C-reactive protein • atherosclerosis

	Introduction

Top Abstract Introduction Methods Results Discussion References

 
Several modifications of LDL (for example, acetylated LDL,^{1 2} oxidized LDL,³ and enzymatically modified LDL⁴ ) induce foam cell formation in vitro via so-called scavenger-receptor² –mediated pathways. However, the uptake of native LDL by macrophages in considerable amounts has never been demonstrated.

Recently, when inflammation was recognized as a major mechanism in atherosclerotic lesion formation,⁵ the involvement of the acute phase reactant C-reactive protein (CRP) became a matter of debate. CRP is an important cardiovascular risk factor^{6 7 8 9} and deposits in the arterial wall during atherogenesis, colocalizing with the terminal complement complex and foam cells.^{10 11 12} CRP upregulates adhesion molecule expression on endothelial cells.¹³ It both opsonizes biological particles¹⁴ and binds to apolipoprotein B–containing lipoproteins (LDL and VLDL) at their Ca²⁺-dependent phosphorylcholine binding sites.^{15 16 17 18 19 20} The major CRP-receptor on human macrophages has been identified as the low-affinity immunoglobulin receptor CD32.²¹ CRP-binding to CD32 is allele-specific.²²

	Methods

Top Abstract Introduction Methods Results Discussion References

 
CRP
Human CRP was purchased from Sigma. Purity and physical state were examined as described previously.¹² CRP preparations were tested by the Limulus endotoxin assay (Sigma).

LDL Uptake Assay
CRP at 900 mg/L was coincubated with native LDL (Sigma) at 1000 mg/dL in PBS containing CaCl₂ (0.132 g/L) and MgCl₂ (0.1 g/L) at room temperature for 15 minutes. The supernatant was then diluted in DMEM/10% AB-serum to a final concentration of 240 mg/L CRP and 250 mg/dL LDL. In control experiments, several lower CRP concentrations (down to 1 mg/L) were used. Before use in the LDL uptake assay, the CRP/LDL coincubate was again centrifuged at 15 000 rpm for 30 minutes to remove high molecular aggregates. A dilution with heat-inactivated 10% AB-serum (56°C for 30 minutes) was used as a control for a potential role of complement activation in our experiments. After a further 15 minutes, the coincubate was cooled to 4°C. Substitutions with PBS instead of CRP or LDL served as controls.

Monocyte Isolation
Monocytes were isolated from heparinized blood⁴ and adjusted with DMEM/10% human AB serum to a density of 1.0x10⁶ cells/mL. Cell suspensions of 50 µL per well were applied to a 4-chamber dish. Cells were cultured for 7 days at 37°C in 5%CO₂ and a medium containing 10% AB serum, which was renewed every 2 days. Macrophages were serum-starved for 12 hours, washed with PBS (4°C), and incubated with CRP/LDL coincubates or controls at 4°C for 30 minutes. The LDL uptake assay was performed by incubating cells at 37°C for stated time intervals. To block CRP-binding to CD32, control cells were incubated with aggregated IgG at 100 µg/mL.²¹ Aggregated IgG was prepared from human IgG (Sigma) by incubation at 63°C for 30 minutes at 10 mg/mL. The phospha-tidylinositol₃-kinase inhibitor Wortmannin at 100 nmol/L, which is known to inhibit Fc receptor-dependent ingestion, was used as an additional control.

CD32 Polymorphism Analysis
For genetic analysis of CD32, genomic DNA was extracted from monocytes using QIAmp-Kit (Qiagen) and subjected to polymerase chain reaction using the following primers: sense, 5'–TTGGATAGTACCTCTGAGACTG–3'; antisense, 5'–ACGTGAGGGCTCCAAGCTCT–3'. Genotype was assessed by DNA-sequencing of polymerase chain reaction products.

Flow Cytometry
Cells were stained for CD32 and the macrophage marker CD14 using monoclonal FITC-conjugated anti-CD32 and R-phycoerythrin–conjugated anti-CD14, both at a 1:20-dilution (Pharmingen). Cells were analyzed using Becton Dickinson FACSCalibur flow cytometer with CellQuest software. Forward and side scatter was used to gate cell population and to exclude cell debris. A minimum of 10 000 positively stained cells were analyzed. Irrelevant anti-mouse isotype-matched antibodies were used as controls.

Immunofluorescent Staining and Analysis
Monocytes were fixed in 4% formaldehyde for 20 minutes and permeabilized by 0.5% Triton X-100. Nonspecific binding was blocked with PBS/2% BSA. Cells were incubated with monoclonal anti-CRP (clone 8, Sigma) at 80 µg/mL or with polyclonal goat anti-apoB-100 (Biodesign) at 10 µg/mL. Cells were incubated with Indodicarbocyanin-conjugated anti-mouse IgG (Jackson-Immuno-Research) at 15 µg/mL or with Indocarbocyanin-conjugated anti-goat antibody (Alexis) at 20 µg/mL. Some samples were incubated with anti-CD32 FITC-conjugated mouse monoclonal antibody (DAKO) at 10 µg/mL or TRITC or FITC-conjugated phalloidin (Sigma), both at 0.1 mg/mL. Finally, cells were mounted in Mowiol (Calbiochem) and visualized under confocal laser scan microscope (63x objective; Leica).

	Results

Top Abstract Introduction Methods Results Discussion References

 
In this study, CRP was coincubated with native LDL in the presence of calcium,^{15 16} and the coincubate was offered to human macrophages expressing the heterozygous phenotype of CD32.^{21 22} Lipoprotein uptake was assessed by confocal laser scanning microscopy. Figure 1A shows the kinetics of LDL (apolipoprotein B-100) staining. After 30 minutes, aggregates of LDL were observed under the ruffled macrophage membrane, indicating formation of LDL-containing vesicles. After 60 minutes, LDL complexes could be observed deeper within the cytoplasm, and they appeared to be more disseminated, suggesting further internalization and processing. Parallel filamentous-actin (f-actin) staining provided evidence for cytoskeletal reorganization in the region of vesicle formation. Time course and morphology of the vesicles suggested that vesicle formation was due to macropinocytosis.²³ In contrast, no vesicle formation was observed when cells were incubated at identical concentrations with native LDL alone or CRP alone. Incubation of cells with native LDL showed some background staining for LDL after 30 minutes (Figure 1B). Decrease in background stain after 60 minutes indicated intracellular LDL degradation^{1 2} .

View larger version (90K): [in this window] [in a new window]   Figure 1. A, Apolipoprotein B-100 stain (red) and f-actin stain (green) after incubation of macrophages with CRP/LDL coincubate. Arrows indicate LDL-containing vesicles. After 30 minutes, vesicles can be observed under ruffled macrophage membrane. After 60 minutes, vesicles are visible deeper within cytoplasm and appear to be more disseminated. B, Apolipoprotein B-100 stain (red) and f-actin stain (green) after incubation of macrophages with LDL alone. After 30 minutes, there seems to be some disseminated apolipoprotein B-100 stain that decreases after 60 minutes, suggesting background uptake of LDL with further digestion. No vesicle formation is visible.

To investigate whether CD32 is involved in vesicle formation, we analyzed CRP and CD32 staining at different time points after incubating cells with the LDL/CRP coincubate (Figure 2A). Figure 2A shows that CRP colocalizes with clusters of CD32 on cell surfaces after 10 minutes. This figure demonstrates extensive CRP capping on the macrophage surface, in analogy to the described interaction of CRP with Fc-receptors on lymphoid cells.²⁴ With further incubation, CRP/CD32 complexes become internalized (Figure 2A). The inset shows that CD32 is localized in the vesicle wall colocalizing with CRP to the vesicle lumen. This phenomenon does not occur after incubating cells with CRP alone (data not shown). Flow cytometric 2-color analysis of anti-CD32 and anti-CD14 revealed a 82.23% stain for CD32 and CD14 (with a 11.91% background stain) before incubation with CRP/LDL and a 23.63% stain for CD32 and CD14 (with a 7.82% background) after CRP/LDL incubation.

View larger version (58K): [in this window] [in a new window]   Figure 2. A, CRP-stain (10-minute inset, shown in blue) and CD32-stain (10-minute inset; shown in red) and f-actin stain (green) after incubating macrophages with CRP/LDL coincubate. Arrows indicate CRP/CD32 complexes (stained violet because of color overlap). After 10 minutes, clustering of CD32 and colocalization of CD32 clusters with CRP are visible on cell membrane. After 30 minutes, CRP/CD32 complexes have been internalized. Observed vesicles contain CD32 in vesicle wall and CRP to vesicle lumen (insert at 30 minutes). B, Apolipoprotein B-100 stain (red) and CRP stain (blue) after 60 minutes of incubating macrophages with CRP/LDL coincubate. Arrows indicate areas of CRP/LDL-colocalization. Vesicles containing both CRP and LDL in colocalization appear violet.

Finally, Figure 2B shows CRP and LDL staining 60 minutes after incubating cells with LDL/CRP coincubates. The figure demonstrates strict colocalization of CRP and LDL in the described vesicles. Because CRP is stained blue and LDL is stained red, vesicles containing CRP and LDL in colocalization are violet.

Further controls included heat inactivation of AB-serum and incubation in the presence of aggregated IgG or Wortmannin (data not shown). Both heat inactivation and aggregated IgG-preincubation abolished vesicle formation and CRP/LDL uptake. Wortmannin preincubation, however, markedly reduced but did not completely abolish vesicle formation. Furthermore, lower CRP concentrations (down to 1 mg/L) revealed significant reductions in but did not completely abolish vesicle formation.

	Discussion

Top Abstract Introduction Methods Results Discussion References

 
In conclusion, our data describe a novel mechanism by which foam cell formation in human atherogenesis may occur. In contrast to the major former hypotheses on foam cell formation in atherogenesis,^{1 2 3} our data suggest a mechanism for LDL uptake by macrophages without a need for biochemical modification of LDL. In our experiments, the acute phase reactant CRP mediated the uptake of native LDL. This effect was dependent on the presence of serum and was abolished by heat inactivation of the serum. Our finding is in line with former reports on CRP-mediated opsonization of biological particles¹⁴ and with a recent finding showing that CRP mediates its effects on endothelial adhesion molecule expression only in the presence of serum.¹⁴ Preliminary evidence from other investigators demonstrate that CD32 may cluster with other receptors, especially complement receptors (G. Schmitz, MD, unpublished observations, 2000). Because CRP is known to activate complement,¹⁰ this potentially important issue awaits further investigation. However, the involvement of other serum factors cannot be excluded.

Uptake of the CRP/LDL coincubate was mediated by CD32, as unequivocally demonstrated by colocalization of CRP, CD32, and LDL in the vesicles and by flow cytometric analysis showing marked reduction of anti-CD32 binding with incubation time. FcR-dependence of vesicle formation is further supported by competitive inhibition through aggregated IgG. Because CRP influences reactive oxygen production by macrophages, CRP may also facilitate LDL oxidation in the atherosclerotic lesion.²⁵ The fact that CRP accumulates in lesions^{10 11 12} suggests the presence of higher CRP concentrations in atherosclerotic tissue than in serum. However, CRP concentrations in the atherosclerotic lesion, which is the location of foam cell formation, are difficult to evaluate.

In view of the well-known property of CRP to opsonize biological particles for macrophages, our finding is in line with basic functions of the immune system. In light of the increasing evidence for CRP being an important cardiovascular risk factor, we suggest that CRP-binding to LDL in the human arterial wall may link LDL deposition to the onset of arteriosclerosis.

	Acknowledgments

 
This work was supported by the Deutsche Forschungsgemeinschaft (SFB451/A4). We thank Dr D. Bowyer and Dr H. Fehling for critical reading of the manuscript.

	Footnotes

 
December 13, 2000; revision received January 11, 2001; accepted January 19, 2001.

	References

Top Abstract Introduction Methods Results Discussion References

 

1. Brown MS, Goldstein JL. A receptor-mediated pathway for cholesterol homeostasis. Science. 1986;232:34–47.[Free Full Text]
   
2. Brown MS, Goldstein JL. Lipoprotein metabolism in the macrophage: implications for cholesterol deposition in atherosclerosis. Ann Rev Biochem. 1983;52:223–261.[Medline] [Order article via Infotrieve]
   
3. Steinberg D, Parthasarathy S, Carew TE, et al. Beyond cholesterol: modifications of low-density lipoprotein that increase its atherogenicity. N Engl J Med. 1989;320:915–924.[Medline] [Order article via Infotrieve]
   
4. Bhakdi S, Dorweiler B, Kirchmann R, et al. On the pathogenesis of atherosclerosis: enzymatic transformation of human low density lipoprotein to an atherogenic moiety. J Exp Med. 1995;182:1959–1971.[Abstract/Free Full Text]
   
5. Ross R. Atherosclerosis: an inflammatory disease. N Engl J Med. 1999;340:115–126.[Free Full Text]
   
6. Liuzzo G, Biasucci LM, Gallimore JR, et al. The prognostic value of C-reactive protein and serum amyloid a protein in severe unstable angina. N Engl J Med. 1994;331:417–424.[Abstract/Free Full Text]
   
7. Haverkate F, Thompson SG, Pyke SD, et al. Production of C-reactive protein and risk of coronary events in stable and unstable angina. Lancet. 1997;349:462–466.[Medline] [Order article via Infotrieve]
   
8. Ridker PM, Cushman M, Stampfer MJ, et al. Inflammation, aspirin, and the risk of cardiovascular disease in apparently healthy men. N Engl J Med. 1997;336:973–979.[Abstract/Free Full Text]
   
9. Koenig W, Sund M, Fröhlich M, et al. C-reactive protein, a sensitive marker of inflammation, predicts future risk of coronary heart disease in initially healthy middle-aged men: results from the MONICA Augsburg Cohort Study, 1984 to 1992. Circulation. 1999;99:237–242.[Abstract/Free Full Text]
   
10. Torzewski J, Torzewski M, Bowyer DE, et al. C-reactive protein frequently colocalizes with the terminal complement complex in the intima of early atherosclerotic lesions of human coronary arteries. Arterioscler Thromb Vasc Biol. 1998;18:1386–1392.[Abstract/Free Full Text]
    
11. Zhang YX, Cliff WJ, Schoefl GI, et al. Coronary C-reactive protein distribution: its relation to development of atherosclerosis. Atherosclerosis. 1999;145:375–379.[Medline] [Order article via Infotrieve]
    
12. Torzewski M, Rist C, Mortensen RF, et al. C-reactive protein in the arterial intima; role of C-reactive protein receptor-dependent monocyte recruitment in atherogenesis. Arterioscler Thromb Vasc Biol. 2000;20:2094–2099.[Abstract/Free Full Text]
    
13. Pasceri V, Willerson JT, Yeh ETH. Direct proinflammatory effects of C-reactive protein on human endothelial cells. Circulation. 2000;102:2165–2168.[Abstract/Free Full Text]
    
14. Mortensen RF, Osmand AP, Lint TF, et al. Interaction of C-reactive protein with lymphocytes and monocytes: complement-dependent adherence and phagocytosis. J Immunol. 1976;117:774-778.[Abstract/Free Full Text]
    
15. deBeer FC, Soutar AK, Baltz ML, et al. Low density lipoprotein and very low density lipoprotein are selectively bound by aggregated C-reactive protein. J Exp Med. 1982;156:230–242.[Abstract/Free Full Text]
    
16. Pepys MB, Rowe IF, Baltz ML. C-reactive protein: binding to lipids and lipoproteins. Int Rev Exp Pathol. 1985;27:83–91.[Medline] [Order article via Infotrieve]
    
17. Cabana GV, Gewurz H, Siegel JN. Interaction of very low density lipoprotein (VLDL) with rabbit C-reactive protein. J Immunol. 1982;128:2342–2348.[Abstract]
    
18. Cabana GV, Gewurz H, Siegel JN. Inflammation-induced changes in rabbit CRP and plasma lipoproteins. J Immunol. 1983;130:1736–1742.[Abstract]
    
19. Thompson D, Pepys MB, Wood SP. The physiological structure of human C-reactive protein and its complex with phosphocholine. Structure Fold Des. 1999;15:169–177.
    
20. Rowe IF, Soutar AK, Trayner IM, et al. Rabbit and rat C-reactive protein bind apolipoprotein B-containing lipoproteins. J Exp Med. 1984;159:604–616.[Abstract/Free Full Text]
    
21. Bharadwaj D, Stein MP, Volzer M, et al. The major receptor for C-reactive protein on leukocytes is fcgamma receptor II. J Exp Med. 1999;190:585–590.[Abstract/Free Full Text]
    
22. Stein MP, Edberg JC, Kimberly RP, et al. C-reactive protein binding to FcgammaRIIa on human monocytes and neutrophils is allele-specific. J Clin Invest. 2000;105:369–376.[Medline] [Order article via Infotrieve]
    
23. Jones NL, Reagan JW, Willingham MC. The pathogenesis of foam cell formation. Modified LDL stimulates uptake of co-incubated LDL via macropinocytosis. Arterioscler Thromb Vasc Biol.. 2000;20:773–781.[Abstract/Free Full Text]
    
24. James K, Baum LL, Gewurz H. Interactions of C-reactive protein with lymphoid cells. Ann N Y Acad Sci. 1982;389:274–285.[Abstract]
    
25. Zeller JM, Sullivan BL. C-reactive protein selectively enhances the intracellular generation of reactive oxygen products by IgG-stimulated monocytes and neutrophils. J Leukoc Biol. 1992;52:449–455.[Abstract]
    

This article has been cited by other articles:

				T. B. Grammer, W. Marz, W. Renner, B. O. Bohm, and M. M. Hoffmann C-reactive protein genotypes associated with circulating C-reactive protein but not with angiographic coronary artery disease: the LURIC study Eur. Heart J., May 21, 2008; (2008) ehn191v1. [Abstract] [Full Text] [PDF]

				U. Singh, M. R. Dasu, P. G. Yancey, A. Afify, S. Devaraj, and I. Jialal Human C-reactive protein promotes oxidized low density lipoprotein uptake and matrix metalloproteinase-9 release in Wistar rats J. Lipid Res., May 1, 2008; 49(5): 1015 - 1023. [Abstract] [Full Text] [PDF]

				S. K. Singh, M. V. Suresh, D. C. Prayther, J. P. Moorman, A. E. Rusinol, and A. Agrawal C-Reactive Protein-Bound Enzymatically Modified Low-Density Lipoprotein Does Not Transform Macrophages into Foam Cells J. Immunol., March 15, 2008; 180(6): 4316 - 4322. [Abstract] [Full Text] [PDF]

				R. R. S. Packard and P. Libby Inflammation in Atherosclerosis: From Vascular Biology to Biomarker Discovery and Risk Prediction Clin. Chem., January 1, 2008; 54(1): 24 - 38. [Abstract] [Full Text] [PDF]

				L. M. Yamaleyeva, K. D. Pendergrass, N. T. Pirro, P. E. Gallagher, L. Groban, and M. C. Chappell Ovariectomy is protective against renal injury in the high-salt-fed older mRen2.Lewis rat Am J Physiol Heart Circ Physiol, October 1, 2007; 293(4): H2064 - H2071. [Abstract] [Full Text] [PDF]

				D. N. Patel, C. A. King, S. R. Bailey, J. W. Holt, K. Venkatachalam, A. Agrawal, A. J. Valente, and B. Chandrasekar Interleukin-17 Stimulates C-reactive Protein Expression in Hepatocytes and Smooth Muscle Cells via p38 MAPK and ERK1/2-dependent NF-{kappa}B and C/EBPbeta Activation J. Biol. Chem., September 14, 2007; 282(37): 27229 - 27238. [Abstract] [Full Text] [PDF]

				D.C.Y. Yeung, A. Xu, C.W.S. Cheung, N.M.S. Wat, M.H. Yau, C.H.Y. Fong, M.T. Chau, and K.S.L. Lam Serum Adipocyte Fatty Acid-Binding Protein Levels Were Independently Associated With Carotid Atherosclerosis Arterioscler. Thromb. Vasc. Biol., August 1, 2007; 27(8): 1796 - 1802. [Abstract] [Full Text] [PDF]

				J. Ryu, C. W. Lee, J.-A. Shin, C.-S. Park, J. J. Kim, S.-J. Park, and K. H. Han Fc{gamma}RIIa mediates C-reactive protein-induced inflammatory responses of human vascular smooth muscle cells by activating NADPH oxidase 4 Cardiovasc Res, August 1, 2007; 75(3): 555 - 565. [Abstract] [Full Text] [PDF]

				T. Palmerini, A. Marzocchi, C. Marrozzini, L. B. Reggiani, C. Savini, G. Marinelli, R. Di Bartolomeo, and A. Branzi Preoperative C-reactive protein levels predict 9-month mortality after coronary artery bypass grafting surgery for the treatment of left main coronary artery stenosis Eur. J. Cardiothorac. Surg., April 1, 2007; 31(4): 685 - 690. [Abstract] [Full Text] [PDF]

				C. Rocker, D. E. Manolov, E. V. Kuzmenkina, K. Tron, H. Slatosch, J. Torzewski, and G. U. Nienhaus Affinity of C-Reactive Protein toward Fc{gamma}RI Is Strongly Enhanced by the {gamma}-Chain Am. J. Pathol., February 1, 2007; 170(2): 755 - 763. [Abstract] [Full Text] [PDF]

				F. Blaschke, Y. Takata, E. Caglayan, A. Collins, P. Tontonoz, W. A. Hsueh, and R. K. Tangirala A Nuclear Receptor Corepressor-Dependent Pathway Mediates Suppression of Cytokine-Induced C-Reactive Protein Gene Expression by Liver X Receptor Circ. Res., December 8, 2006; 99(12): e88 - e99. [Abstract] [Full Text] [PDF]

				U. Singh, S. Devaraj, M. R. Dasu, D. Ciobanu, J. Reusch, and I. Jialal C-Reactive Protein Decreases Interleukin-10 Secretion in Activated Human Monocyte-Derived Macrophages via Inhibition of Cyclic AMP Production Arterioscler. Thromb. Vasc. Biol., November 1, 2006; 26(11): 2469 - 2475. [Abstract] [Full Text] [PDF]

				M. Juonala, J. S.A. Viikari, T. Ronnemaa, L. Taittonen, J. Marniemi, and O. T. Raitakari Childhood C-Reactive Protein in Predicting CRP and Carotid Intima-Media Thickness in Adulthood: The Cardiovascular Risk in Young Finns Study Arterioscler. Thromb. Vasc. Biol., August 1, 2006; 26(8): 1883 - 1888. [Abstract] [Full Text] [PDF]

				R. Somani, P. J. Grant, K. Kain, A. J. Catto, and A. M. Carter Complement C3 and C-Reactive Protein Are Elevated in South Asians Independent of a Family History of Stroke Stroke, August 1, 2006; 37(8): 2001 - 2006. [Abstract] [Full Text] [PDF]

				E. Paffen and M. P.M. deMaat C-reactive protein in atherosclerosis: A causal factor? Cardiovasc Res, July 1, 2006; 71(1): 30 - 39. [Abstract] [Full Text] [PDF]

				A. Guven, A. Cetinkaya, M. Aral, G. Sokmen, M. A. Buyukbese, A. Guven, and N. Koksal High-Sensitivity C-Reactive Protein in Patients with Metabolic Syndrome Angiology, May 1, 2006; 57(3): 295 - 302. [Abstract] [PDF]

				M. Hermann and F. Ruschitzka Novel anti-inflammatory drugs in hypertension Nephrol. Dial. Transplant., April 1, 2006; 21(4): 859 - 864. [Full Text] [PDF]

				K M J Douglas, A V Pace, G J Treharne, A Saratzis, P Nightingale, N Erb, M J Banks, and G D Kitas Excess recurrent cardiac events in rheumatoid arthritis patients with acute coronary syndrome Ann Rheum Dis, March 1, 2006; 65(3): 348 - 353. [Abstract] [Full Text] [PDF]

				E. J. Armstrong, D. A. Morrow, and M. S. Sabatine Inflammatory Biomarkers in Acute Coronary Syndromes: Part II: Acute-Phase Reactants and Biomarkers of Endothelial Cell Activation Circulation, February 21, 2006; 113(7): e152 - e155. [Full Text] [PDF]

				M. Can, S. Acikgoz, G. Mungan, T. Bayraktaroglu, E. Kocak, B. Guven, and S. Demirtas Serum cardiovascular risk factors in obstructive sleep apnea. Chest, February 1, 2006; 129(2): 233 - 237. [Abstract] [Full Text] [PDF]

				M. Soinio, J. Marniemi, M. Laakso, S. Lehto, and T. Ronnemaa High-Sensitivity C-Reactive Protein and Coronary Heart Disease Mortality in Patients With Type 2 Diabetes: A 7-year follow-up study Diabetes Care, February 1, 2006; 29(2): 329 - 333. [Abstract] [Full Text] [PDF]

				M Meuwissen, A C van der Wal, H W M Niessen, K T Koch, R J de Winter, C M van der Loos, S Z H Rittersma, S A J Chamuleau, J G P Tijssen, A E Becker, et al. Colocalisation of intraplaque C reactive protein, complement, oxidised low density lipoprotein, and macrophages in stable and unstable angina and acute myocardial infarction J. Clin. Pathol., February 1, 2006; 59(2): 196 - 201. [Abstract] [Full Text] [PDF]

				Y. Wakugawa, Y. Kiyohara, Y. Tanizaki, M. Kubo, T. Ninomiya, J. Hata, Y. Doi, K. Okubo, Y. Oishi, K. Shikata, et al. C-Reactive Protein and Risk of First-Ever Ischemic and Hemorrhagic Stroke in a General Japanese Population: The Hisayama Study Stroke, January 1, 2006; 37(1): 27 - 32. [Abstract] [Full Text] [PDF]

				P. Y. Hsue and D. D. Waters What a Cardiologist Needs to Know About Patients With Human Immunodeficiency Virus Infection Circulation, December 20, 2005; 112(25): 3947 - 3957. [Abstract] [Full Text] [PDF]

				I. Ciubotaru, L. A. Potempa, and R. C. Wander Production of Modified C-Reactive Protein in U937-Derived Macrophages Experimental Biology and Medicine, November 1, 2005; 230(10): 762 - 770. [Abstract] [Full Text] [PDF]

				J. Torzewski C-Reactive Protein and Atherogenesis: New Insights from Established Animal Models Am. J. Pathol., October 1, 2005; 167(4): 923 - 925. [Full Text] [PDF]

				H. Sun, T. Koike, T. Ichikawa, K. Hatakeyama, M. Shiomi, B. Zhang, S. Kitajima, M. Morimoto, T. Watanabe, Y. Asada, et al. C-Reactive Protein in Atherosclerotic Lesions: Its Origin and Pathophysiological Significance Am. J. Pathol., October 1, 2005; 167(4): 1139 - 1148. [Abstract] [Full Text] [PDF]

				V. Fuster, P. R. Moreno, Z. A. Fayad, R. Corti, and J. J. Badimon Atherothrombosis and High-Risk Plaque: Part I: Evolving Concepts J. Am. Coll. Cardiol., September 20, 2005; 46(6): 937 - 954. [Abstract] [Full Text] [PDF]

				A. Trion, M.P.M. de Maat, J.W. Jukema, A. van der Laarse, M.C. Maas, E.H. Offerman, L.M. Havekes, A.J. Szalai, H.M.G. Princen, and J.J. Emeis No Effect of C-Reactive Protein on Early Atherosclerosis Development in Apolipoprotein E*3-Leiden/Human C-Reactive Protein Transgenic Mice Arterioscler. Thromb. Vasc. Biol., August 1, 2005; 25(8): 1635 - 1640. [Abstract] [Full Text] [PDF]

				C. Liu, S. Wang, A. Deb, K. A. Nath, Z. S. Katusic, J. P. McConnell, and N. M. Caplice Proapoptotic, Antimigratory, Antiproliferative, and Antiangiogenic Effects of Commercial C-Reactive Protein on Various Human Endothelial Cell Types In Vitro: Implications of Contaminating Presence of Sodium Azide in Commercial Preparation Circ. Res., July 22, 2005; 97(2): 135 - 143. [Abstract] [Full Text] [PDF]

				C. Arnaud, F. Burger, S. Steffens, N. R. Veillard, T. H. Nguyen, D. Trono, and F. Mach Statins Reduce Interleukin-6-Induced C-Reactive Protein in Human Hepatocytes: New Evidence for Direct Antiinflammatory Effects of Statins Arterioscler. Thromb. Vasc. Biol., June 1, 2005; 25(6): 1231 - 1236. [Abstract] [Full Text] [PDF]

				M. Di Napoli, M. Schwaninger, R. Cappelli, E. Ceccarelli, G. Di Gianfilippo, C. Donati, H. C.A. Emsley, S. Forconi, S. J. Hopkins, L. Masotti, et al. Evaluation of C-Reactive Protein Measurement for Assessing the Risk and Prognosis in Ischemic Stroke: A Statement for Health Care Professionals From the CRP Pooling Project Members Stroke, June 1, 2005; 36(6): 1316 - 1329. [Abstract] [Full Text] [PDF]

				E. Qamirani, Y. Ren, L. Kuo, and T. W. Hein C-Reactive Protein Inhibits Endothelium-Dependent NO-Mediated Dilation in Coronary Arterioles by Activating p38 Kinase and NAD(P)H Oxidase Arterioscler. Thromb. Vasc. Biol., May 1, 2005; 25(5): 995 - 1001. [Abstract] [Full Text] [PDF]

				K. F. Hilpert, P. M. Kris-Etherton, and S. G. West Lipid Response to a Low-Fat Diet with or without Soy Is Modified by C-Reactive Protein Status in Moderately Hypercholesterolemic Adults J. Nutr., May 1, 2005; 135(5): 1075 - 1079. [Abstract] [Full Text] [PDF]

				P. K. MacCallum Markers of Hemostasis and Systemic Inflammation in Heart Disease and Atherosclerosis in Smokers Proceedings of the ATS, April 1, 2005; 2(1): 34 - 43. [Abstract] [Full Text] [PDF]

				Y Sato, K Hatakeyama, A Yamashita, K Marutsuka, A Sumiyoshi, and Y Asada Proportion of fibrin and platelets differs in thrombi on ruptured and eroded coronary atherosclerotic plaques in humans Heart, April 1, 2005; 91(4): 526 - 530. [Abstract] [Full Text] [PDF]

L. van Tits, J. de Graaf, H. Toenhake, W. van Heerde, and A. Stalenhoef C-Reactive Protein and Annexin A5 Bind to Distinct Sites of Negatively Charged Phospholipids Present in Oxidized Low-Density Lipoprotein Arterioscler. Thromb. Vasc. Biol., April 1, 2005; 25(4): 717 - 722.