(Circulation. 2001;103:1194.)
© 2001 American Heart Association, Inc.
Brief Rapid Communications |
From Internal Medicine IICardiology, University of Ulm, Ulm, Germany.
Correspondence to Jan Torzewski, MD, MPhil, Internal Medicine II, Cardiology, University of Ulm, Robert Koch-Str 8, 89081 Ulm, Germany. E-mail jan.torzewski{at}medizin.uni-ulm.de
| Abstract |
|---|
|
|
|---|
Methods and ResultsMonocytes were isolated from human blood and transformed into macrophages. CRP/LDL uptake was assessed by immunofluorescent labeling and the use of confocal laser scanning microscopy. Native LDL coincubated with CRP was taken up by macrophages by macropinocytosis. Uptake of the CRP/LDL coincubate was mediated by the CRP receptor CD32.
ConclusionsWe conclude that foam cell formation in human atherogenesis may be caused in part by uptake of CRP-opsonized native LDL.
Key Words: lipids C-reactive protein atherosclerosis
| Introduction |
|---|
|
|
|---|
Recently, when inflammation was recognized as a major mechanism in atherosclerotic lesion formation,5 the involvement of the acute phase reactant C-reactive protein (CRP) became a matter of debate. CRP is an important cardiovascular risk factor6 7 8 9 and deposits in the arterial wall during atherogenesis, colocalizing with the terminal complement complex and foam cells.10 11 12 CRP upregulates adhesion molecule expression on endothelial cells.13 It both opsonizes biological particles14 and binds to apolipoprotein Bcontaining lipoproteins (LDL and VLDL) at their Ca2+-dependent phosphorylcholine binding sites.15 16 17 18 19 20 The major CRP-receptor on human macrophages has been identified as the low-affinity immunoglobulin receptor CD32.21 CRP-binding to CD32 is allele-specific.22
| Methods |
|---|
|
|
|---|
LDL Uptake Assay
CRP at 900 mg/L was coincubated with native LDL
(Sigma) at 1000 mg/dL in PBS containing CaCl2
(0.132 g/L) and MgCl2 (0.1 g/L) at room
temperature for 15 minutes. The supernatant was then diluted in
DMEM/10% AB-serum to a final concentration of 240 mg/L CRP and 250
mg/dL LDL. In control experiments, several lower CRP concentrations
(down to 1 mg/L) were used. Before use in the LDL uptake assay, the
CRP/LDL coincubate was again centrifuged at 15 000 rpm for 30 minutes
to remove high molecular aggregates. A dilution with heat-inactivated
10% AB-serum (56°C for 30 minutes) was used as a control for a
potential role of complement activation in our experiments. After a
further 15 minutes, the coincubate was cooled to 4°C. Substitutions
with PBS instead of CRP or LDL served as
controls.
Monocyte Isolation
Monocytes were isolated from heparinized
blood4 and adjusted with
DMEM/10% human AB serum to a density of
1.0x106 cells/mL. Cell suspensions of 50
µL per well were applied to a 4-chamber dish. Cells were cultured for
7 days at 37°C in 5%CO2 and a medium
containing 10% AB serum, which was renewed every 2 days. Macrophages
were serum-starved for 12 hours, washed with PBS (4°C), and incubated
with CRP/LDL coincubates or controls at 4°C for 30 minutes. The LDL
uptake assay was performed by incubating cells at 37°C for stated
time intervals. To block CRP-binding to CD32, control cells were
incubated with aggregated IgG at 100
µg/mL.21 Aggregated IgG
was prepared from human IgG (Sigma) by incubation at 63°C for 30
minutes at 10 mg/mL. The
phospha-tidylinositol3-kinase inhibitor
Wortmannin at 100 nmol/L, which is known to inhibit Fc
receptor-dependent ingestion, was used as an additional
control.
CD32 Polymorphism Analysis
For genetic analysis of CD32, genomic DNA was
extracted from monocytes using QIAmp-Kit (Qiagen) and subjected to
polymerase chain reaction using the following primers: sense,
5'TTGGATAGTACCTCTGAGACTG3'; antisense,
5'ACGTGAGGGCTCCAAGCTCT3'. Genotype was assessed by DNA-sequencing
of polymerase chain reaction products.
Flow Cytometry
Cells were stained for CD32 and the macrophage marker
CD14 using monoclonal FITC-conjugated anti-CD32 and
R-phycoerythrinconjugated anti-CD14, both at a 1:20-dilution
(Pharmingen). Cells were analyzed using Becton Dickinson FACSCalibur
flow cytometer with CellQuest software. Forward and side scatter was
used to gate cell population and to exclude cell debris. A minimum of
10 000 positively stained cells were analyzed. Irrelevant anti-mouse
isotype-matched antibodies were used as controls.
Immunofluorescent Staining and Analysis
Monocytes were fixed in 4% formaldehyde for 20
minutes and permeabilized by 0.5% Triton X-100. Nonspecific binding
was blocked with PBS/2% BSA. Cells were incubated with monoclonal
anti-CRP (clone 8, Sigma) at 80 µg/mL or with polyclonal goat
anti-apoB-100 (Biodesign) at 10 µg/mL. Cells were incubated with
Indodicarbocyanin-conjugated anti-mouse IgG
(Jackson-Immuno-Research) at 15 µg/mL or with
Indocarbocyanin-conjugated anti-goat antibody (Alexis) at 20 µg/mL.
Some samples were incubated with anti-CD32 FITC-conjugated mouse
monoclonal antibody (DAKO) at 10 µg/mL or TRITC or FITC-conjugated
phalloidin (Sigma), both at 0.1 mg/mL. Finally, cells were mounted in
Mowiol (Calbiochem) and visualized under confocal laser scan microscope
(63x objective; Leica).
| Results |
|---|
|
|
|---|
|
To investigate whether CD32 is involved in vesicle
formation, we analyzed CRP and CD32 staining at different time points
after incubating cells with the LDL/CRP coincubate
(Figure 2A
).
Figure 2A
shows that CRP colocalizes with clusters of CD32
on cell surfaces after 10 minutes. This figure demonstrates extensive
CRP capping on the macrophage surface, in analogy to the described
interaction of CRP with Fc-receptors on lymphoid
cells.24 With further
incubation, CRP/CD32 complexes become internalized
(Figure 2A
). The inset shows that CD32 is localized in the
vesicle wall colocalizing with CRP to the vesicle lumen. This
phenomenon does not occur after incubating cells with CRP alone (data
not shown). Flow cytometric 2-color analysis of anti-CD32 and anti-CD14
revealed a 82.23% stain for CD32 and CD14 (with a 11.91% background
stain) before incubation with CRP/LDL and a 23.63% stain for CD32 and
CD14 (with a 7.82% background) after CRP/LDL incubation.
|
Finally,
Figure 2B
shows CRP and LDL staining 60 minutes after
incubating cells with LDL/CRP coincubates. The figure demonstrates
strict colocalization of CRP and LDL in the described vesicles. Because
CRP is stained blue and LDL is stained red, vesicles containing CRP and
LDL in colocalization are violet.
Further controls included heat inactivation of AB-serum and incubation in the presence of aggregated IgG or Wortmannin (data not shown). Both heat inactivation and aggregated IgG-preincubation abolished vesicle formation and CRP/LDL uptake. Wortmannin preincubation, however, markedly reduced but did not completely abolish vesicle formation. Furthermore, lower CRP concentrations (down to 1 mg/L) revealed significant reductions in but did not completely abolish vesicle formation.
| Discussion |
|---|
|
|
|---|
Uptake of the CRP/LDL coincubate was mediated by CD32, as unequivocally demonstrated by colocalization of CRP, CD32, and LDL in the vesicles and by flow cytometric analysis showing marked reduction of anti-CD32 binding with incubation time. FcR-dependence of vesicle formation is further supported by competitive inhibition through aggregated IgG. Because CRP influences reactive oxygen production by macrophages, CRP may also facilitate LDL oxidation in the atherosclerotic lesion.25 The fact that CRP accumulates in lesions10 11 12 suggests the presence of higher CRP concentrations in atherosclerotic tissue than in serum. However, CRP concentrations in the atherosclerotic lesion, which is the location of foam cell formation, are difficult to evaluate.
In view of the well-known property of CRP to opsonize biological particles for macrophages, our finding is in line with basic functions of the immune system. In light of the increasing evidence for CRP being an important cardiovascular risk factor, we suggest that CRP-binding to LDL in the human arterial wall may link LDL deposition to the onset of arteriosclerosis.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
2. Brown MS, Goldstein JL. Lipoprotein metabolism in the macrophage: implications for cholesterol deposition in atherosclerosis. Ann Rev Biochem. 1983;52:223261.[Medline] [Order article via Infotrieve]
3. Steinberg D, Parthasarathy S, Carew TE, et al. Beyond cholesterol: modifications of low-density lipoprotein that increase its atherogenicity. N Engl J Med. 1989;320:915924.[Medline] [Order article via Infotrieve]
4.
Bhakdi S, Dorweiler
B, Kirchmann R, et al. On the pathogenesis of atherosclerosis:
enzymatic transformation of human low density lipoprotein to an
atherogenic moiety. J Exp Med. 1995;182:19591971.
5.
Ross R.
Atherosclerosis: an inflammatory disease.
N Engl J Med. 1999;340:115126.
6.
Liuzzo G, Biasucci
LM, Gallimore JR, et al. The prognostic value of C-reactive protein and
serum amyloid a protein in severe unstable angina.
N Engl J Med. 1994;331:417424.
7. Haverkate F, Thompson SG, Pyke SD, et al. Production of C-reactive protein and risk of coronary events in stable and unstable angina. Lancet. 1997;349:462466.[Medline] [Order article via Infotrieve]
8.
Ridker PM, Cushman
M, Stampfer MJ, et al. Inflammation, aspirin, and the risk of
cardiovascular disease in apparently healthy men.
N Engl J Med. 1997;336:973979.
9.
Koenig W, Sund M,
Fröhlich M, et al. C-reactive protein, a sensitive marker of
inflammation, predicts future risk of coronary heart disease in
initially healthy middle-aged men: results from the MONICA Augsburg
Cohort Study, 1984 to 1992.
Circulation. 1999;99:237242.
10.
Torzewski J,
Torzewski M, Bowyer DE, et al. C-reactive protein frequently
colocalizes with the terminal complement complex in the intima of early
atherosclerotic lesions of human coronary arteries.
Arterioscler Thromb Vasc Biol. 1998;18:13861392.
11. Zhang YX, Cliff WJ, Schoefl GI, et al. Coronary C-reactive protein distribution: its relation to development of atherosclerosis. Atherosclerosis. 1999;145:375379.[Medline] [Order article via Infotrieve]
12.
Torzewski M, Rist
C, Mortensen RF, et al. C-reactive protein in the arterial intima; role
of C-reactive protein receptor-dependent monocyte recruitment in
atherogenesis. Arterioscler Thromb Vasc
Biol. 2000;20:20942099.
13.
Pasceri V,
Willerson JT, Yeh ETH. Direct proinflammatory effects of C-reactive
protein on human endothelial cells.
Circulation. 2000;102:21652168.
14.
Mortensen RF,
Osmand AP, Lint TF, et al. Interaction of C-reactive protein with
lymphocytes and monocytes: complement-dependent adherence and
phagocytosis. J Immunol. 1976;117:774-778.
15.
deBeer FC, Soutar
AK, Baltz ML, et al. Low density lipoprotein and very low density
lipoprotein are selectively bound by aggregated C-reactive protein.
J Exp Med. 1982;156:230242.
16. Pepys MB, Rowe IF, Baltz ML. C-reactive protein: binding to lipids and lipoproteins. Int Rev Exp Pathol. 1985;27:8391.[Medline] [Order article via Infotrieve]
17. Cabana GV, Gewurz H, Siegel JN. Interaction of very low density lipoprotein (VLDL) with rabbit C-reactive protein. J Immunol. 1982;128:23422348.[Abstract]
18. Cabana GV, Gewurz H, Siegel JN. Inflammation-induced changes in rabbit CRP and plasma lipoproteins. J Immunol. 1983;130:17361742.[Abstract]
19. Thompson D, Pepys MB, Wood SP. The physiological structure of human C-reactive protein and its complex with phosphocholine. Structure Fold Des. 1999;15:169177.
20.
Rowe IF, Soutar
AK, Trayner IM, et al. Rabbit and rat C-reactive protein bind
apolipoprotein B-containing lipoproteins.
J Exp Med. 1984;159:604616.
21.
Bharadwaj D,
Stein MP, Volzer M, et al. The major receptor for C-reactive protein on
leukocytes is fcgamma receptor II. J Exp
Med. 1999;190:585590.
22. Stein MP, Edberg JC, Kimberly RP, et al. C-reactive protein binding to FcgammaRIIa on human monocytes and neutrophils is allele-specific. J Clin Invest. 2000;105:369376.[Medline] [Order article via Infotrieve]
23.
Jones NL, Reagan
JW, Willingham MC. The pathogenesis of foam cell formation. Modified
LDL stimulates uptake of co-incubated LDL via macropinocytosis.
Arterioscler Thromb Vasc Biol.. 2000;20:773781.
24. James K, Baum LL, Gewurz H. Interactions of C-reactive protein with lymphoid cells. Ann N Y Acad Sci. 1982;389:274285.[Medline] [Order article via Infotrieve]
25. Zeller JM, Sullivan BL. C-reactive protein selectively enhances the intracellular generation of reactive oxygen products by IgG-stimulated monocytes and neutrophils. J Leukoc Biol. 1992;52:449455.[Abstract]
This article has been cited by other articles:
![]() |
F. J Khawaja and I. J Kullo Novel markers of peripheral arterial disease Vascular Medicine, November 1, 2009; 14(4): 381 - 392. [Abstract] [PDF] |
||||
![]() |
A. S. Leon and U. G. Bronas Pathophysiology of Coronary Heart Disease and Biological Mechanisms for the Cardioprotective Effects of Regular Aerobic Exercise American Journal of Lifestyle Medicine, September 1, 2009; 3(5): 379 - 385. [Abstract] [PDF] |
||||
![]() |
K. Ishida, M. Kato, Y. Kato, K. Yanagihara, Y. Kinugasa, K. Kotani, O. Igawa, I. Hisatome, C. Shigemasa, and V. K. Somers Appropriate Use of Nasal Continuous Positive Airway Pressure Decreases Elevated C-Reactive Protein in Patients With Obstructive Sleep Apnea Chest, July 1, 2009; 136(1): 125 - 129. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Devaraj, U. Singh, and I. Jialal The Evolving Role of C-Reactive Protein in Atherothrombosis Clin. Chem., February 1, 2009; 55(2): 229 - 238. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. B. Grammer, W. Marz, W. Renner, B. O. Bohm, and M. M. Hoffmann C-reactive protein genotypes associated with circulating C-reactive protein but not with angiographic coronary artery disease: the LURIC study Eur. Heart J., January 2, 2009; 30(2): 170 - 182. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Eickhoff, A. Valipour, D. Kiss, M. Schreder, L. Cekici, K. Geyer, R. Kohansal, and O. C. Burghuber Determinants of Systemic Vascular Function in Patients with Stable Chronic Obstructive Pulmonary Disease Am. J. Respir. Crit. Care Med., December 15, 2008; 178(12): 1211 - 1218. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Ho, C. D. Owens, T. Longo, X. X. Sui, C. Ifantides, and M. S. Conte C-reactive protein and vein graft disease: evidence for a direct effect on smooth muscle cell phenotype via modulation of PDGF receptor-{beta} Am J Physiol Heart Circ Physiol, September 1, 2008; 295(3): H1132 - H1140. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Singh, M. R. Dasu, P. G. Yancey, A. Afify, S. Devaraj, and I. Jialal Human C-reactive protein promotes oxidized low density lipoprotein uptake and matrix metalloproteinase-9 release in Wistar rats J. Lipid Res., May 1, 2008; 49(5): 1015 - 1023. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. K. Singh, M. V. Suresh, D. C. Prayther, J. P. Moorman, A. E. Rusinol, and A. Agrawal C-Reactive Protein-Bound Enzymatically Modified Low-Density Lipoprotein Does Not Transform Macrophages into Foam Cells J. Immunol., March 15, 2008; 180(6): 4316 - 4322. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. R. S. Packard and P. Libby Inflammation in Atherosclerosis: From Vascular Biology to Biomarker Discovery and Risk Prediction Clin. Chem., January 1, 2008; 54(1): 24 - 38. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. Yamaleyeva, K. D. Pendergrass, N. T. Pirro, P. E. Gallagher, L. Groban, and M. C. Chappell Ovariectomy is protective against renal injury in the high-salt-fed older mRen2.Lewis rat Am J Physiol Heart Circ Physiol, October 1, 2007; 293(4): H2064 - H2071. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. N. Patel, C. A. King, S. R. Bailey, J. W. Holt, K. Venkatachalam, A. Agrawal, A. J. Valente, and B. Chandrasekar Interleukin-17 Stimulates C-reactive Protein Expression in Hepatocytes and Smooth Muscle Cells via p38 MAPK and ERK1/2-dependent NF-{kappa}B and C/EBPbeta Activation J. Biol. Chem., September 14, 2007; 282(37): 27229 - 27238. [Abstract] [Full Text] [PDF] |
||||
![]() |
D.C.Y. Yeung, A. Xu, C.W.S. Cheung, N.M.S. Wat, M.H. Yau, C.H.Y. Fong, M.T. Chau, and K.S.L. Lam Serum Adipocyte Fatty Acid-Binding Protein Levels Were Independently Associated With Carotid Atherosclerosis Arterioscler Thromb Vasc Biol, August 1, 2007; 27(8): 1796 - 1802. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Ryu, C. W. Lee, J.-A. Shin, C.-S. Park, J. J. Kim, S.-J. Park, and K. H. Han Fc{gamma}RIIa mediates C-reactive protein-induced inflammatory responses of human vascular smooth muscle cells by activating NADPH oxidase 4 Cardiovasc Res, August 1, 2007; 75(3): 555 - 565. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Palmerini, A. Marzocchi, C. Marrozzini, L. B. Reggiani, C. Savini, G. Marinelli, R. Di Bartolomeo, and A. Branzi Preoperative C-reactive protein levels predict 9-month mortality after coronary artery bypass grafting surgery for the treatment of left main coronary artery stenosis Eur. J. Cardiothorac. Surg., April 1, 2007; 31(4): 685 - 690. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Rocker, D. E. Manolov, E. V. Kuzmenkina, K. Tron, H. Slatosch, J. Torzewski, and G. U. Nienhaus Affinity of C-Reactive Protein toward Fc{gamma}RI Is Strongly Enhanced by the {gamma}-Chain Am. J. Pathol., February 1, 2007; 170(2): 755 - 763. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Blaschke, Y. Takata, E. Caglayan, A. Collins, P. Tontonoz, W. A. Hsueh, and R. K. Tangirala A Nuclear Receptor Corepressor-Dependent Pathway Mediates Suppression of Cytokine-Induced C-Reactive Protein Gene Expression by Liver X Receptor Circ. Res., December 8, 2006; 99(12): e88 - e99. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Yu, S. J Murdoch, S. J Parikh, S. M Marcovina, A. Cobitz, H. Chen, and J. D Brunzell Rosiglitazone increases LDL particle size and buoyancy and decreases C-reactive protein in patients with type 2 diabetes on statin therapy Diabetes and Vascular Disease Research, December 1, 2006; 3(3): 189 - 196. [Abstract] [PDF] |
||||
![]() |
M McMahon, J Grossman, W Chen, and B H Hahn Inflammation and the pathogenesis of atherosclerosis in systemic lupus erythematosus Lupus, November 1, 2006; 15(11_suppl): 59 - 69. [Abstract] [PDF] |
||||
![]() |
U. Singh, S. Devaraj, M. R. Dasu, D. Ciobanu, J. Reusch, and I. Jialal C-Reactive Protein Decreases Interleukin-10 Secretion in Activated Human Monocyte-Derived Macrophages via Inhibition of Cyclic AMP Production Arterioscler Thromb Vasc Biol, November 1, 2006; 26(11): 2469 - 2475. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Juonala, J. S.A. Viikari, T. Ronnemaa, L. Taittonen, J. Marniemi, and O. T. Raitakari Childhood C-Reactive Protein in Predicting CRP and Carotid Intima-Media Thickness in Adulthood: The Cardiovascular Risk in Young Finns Study Arterioscler Thromb Vasc Biol, August 1, 2006; 26(8): 1883 - 1888. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Somani, P. J. Grant, K. Kain, A. J. Catto, and A. M. Carter Complement C3 and C-Reactive Protein Are Elevated in South Asians Independent of a Family History of Stroke Stroke, August 1, 2006; 37(8): 2001 - 2006. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Paffen and M. P.M. deMaat C-reactive protein in atherosclerosis: A causal factor? Cardiovasc Res, July 1, 2006; 71(1): 30 - 39. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Guven, A. Cetinkaya, M. Aral, G. Sokmen, M. A. Buyukbese, A. Guven, and N. Koksal High-Sensitivity C-Reactive Protein in Patients with Metabolic Syndrome Angiology, May 1, 2006; 57(3): 295 - 302. [Abstract] [PDF] |
||||
![]() |
M. Hermann and F. Ruschitzka Novel anti-inflammatory drugs in hypertension Nephrol. Dial. Transplant., April 1, 2006; 21(4): 859 - 864. [Full Text] [PDF] |
||||
![]() |
K M J Douglas, A V Pace, G J Treharne, A Saratzis, P Nightingale, N Erb, M J Banks, and G D Kitas Excess recurrent cardiac events in rheumatoid arthritis patients with acute coronary syndrome Ann Rheum Dis, March 1, 2006; 65(3): 348 - 353. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. J. Armstrong, D. A. Morrow, and M. S. Sabatine Inflammatory Biomarkers in Acute Coronary Syndromes: Part II: Acute-Phase Reactants and Biomarkers of Endothelial Cell Activation Circulation, February 21, 2006; 113(7): e152 - e155. [Full Text] [PDF] |
||||
![]() |
M. Can, S. Acikgoz, G. Mungan, T. Bayraktaroglu, E. Kocak, B. Guven, and S. Demirtas Serum cardiovascular risk factors in obstructive sleep apnea. Chest, February 1, 2006; 129(2): 233 - 237. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Soinio, J. Marniemi, M. Laakso, S. Lehto, and T. Ronnemaa High-Sensitivity C-Reactive Protein and Coronary Heart Disease Mortality in Patients With Type 2 Diabetes: A 7-year follow-up study Diabetes Care, February 1, 2006; 29(2): 329 - 333. [Abstract] [Full Text] [PDF] |
||||
![]() |
M Meuwissen, A C van der Wal, H W M Niessen, K T Koch, R J de Winter, C M van der Loos, S Z H Rittersma, S A J Chamuleau, J G P Tijssen, A E Becker, et al. Colocalisation of intraplaque C reactive protein, complement, oxidised low density lipoprotein, and macrophages in stable and unstable angina and acute myocardial infarction J. Clin. Pathol., February 1, 2006; 59(2): 196 - 201. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Wakugawa, Y. Kiyohara, Y. Tanizaki, M. Kubo, T. Ninomiya, J. Hata, Y. Doi, K. Okubo, Y. Oishi, K. Shikata, et al. C-Reactive Protein and Risk of First-Ever Ischemic and Hemorrhagic Stroke in a General Japanese Population: The Hisayama Study Stroke, January 1, 2006; 37(1): 27 - 32. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Y. Hsue and D. D. Waters What a Cardiologist Needs to Know About Patients With Human Immunodeficiency Virus Infection Circulation, December 20, 2005; 112(25): 3947 - 3957. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Ciubotaru, L. A. Potempa, and R. C. Wander Production of Modified C-Reactive Protein in U937-Derived Macrophages Experimental Biology and Medicine, November 1, 2005; 230(10): 762 - 770. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M Carter Inflammation, thrombosis and acute coronary syndromes Diabetes and Vascular Disease Research, October 1, 2005; 2(3): 113 - 121. [Abstract] [PDF] |
||||
![]() |
J. Torzewski C-Reactive Protein and Atherogenesis: New Insights from Established Animal Models Am. J. Pathol., October 1, 2005; 167(4): 923 - 925. [Full Text] [PDF] |
||||
![]() |
H. Sun, T. Koike, T. Ichikawa, K. Hatakeyama, M. Shiomi, B. Zhang, S. Kitajima, M. Morimoto, T. Watanabe, Y. Asada, et al. C-Reactive Protein in Atherosclerotic Lesions: Its Origin and Pathophysiological Significance Am. J. Pathol., October 1, 2005; 167(4): 1139 - 1148. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Fuster, P. R. Moreno, Z. A. Fayad, R. Corti, and J. J. Badimon Atherothrombosis and High-Risk Plaque: Part I: Evolving Concepts J. Am. Coll. Cardiol., September 20, 2005; 46(6): 937 - 954. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Trion, M.P.M. de Maat, J.W. Jukema, A. van der Laarse, M.C. Maas, E.H. Offerman, L.M. Havekes, A.J. Szalai, H.M.G. Princen, and J.J. Emeis No Effect of C-Reactive Protein on Early Atherosclerosis Development in Apolipoprotein E*3-Leiden/Human C-Reactive Protein Transgenic Mice Arterioscler Thromb Vasc Biol, August 1, 2005; 25(8): 1635 - 1640. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Liu, S. Wang, A. Deb, K. A. Nath, Z. S. Katusic, J. P. McConnell, and N. M. Caplice Proapoptotic, Antimigratory, Antiproliferative, and Antiangiogenic Effects of Commercial C-Reactive Protein on Various Human Endothelial Cell Types In Vitro: Implications of Contaminating Presence of Sodium Azide in Commercial Preparation Circ. Res., July 22, 2005; 97(2): 135 - 143. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Arnaud, F. Burger, S. Steffens, N. R. Veillard, T. H. Nguyen, D. Trono, and F. Mach Statins Reduce Interleukin-6-Induced C-Reactive Protein in Human Hepatocytes: New Evidence for Direct Antiinflammatory Effects of Statins Arterioscler Thromb Vasc Biol, June 1, 2005; 25(6): 1231 - 1236. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Di Napoli, M. Schwaninger, R. Cappelli, E. Ceccarelli, G. Di Gianfilippo, C. Donati, H. C.A. Emsley, S. Forconi, S. J. Hopkins, L. Masotti, et al. Evaluation of C-Reactive Protein Measurement for Assessing the Risk and Prognosis in Ischemic Stroke: A Statement for Health Care Professionals From the CRP Pooling Project Members Stroke, June 1, 2005; 36(6): 1316 - 1329. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Qamirani, Y. Ren, L. Kuo, and T. W. Hein C-Reactive Protein Inhibits Endothelium-Dependent NO-Mediated Dilation in Coronary Arterioles by Activating p38 Kinase and NAD(P)H Oxidase Arterioscler Thromb Vasc Biol, May 1, 2005; 25(5): 995 - 1001. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. F. Hilpert, P. M. Kris-Etherton, and S. G. West Lipid Response to a Low-Fat Diet with or without Soy Is Modified by C-Reactive Protein Status in Moderately Hypercholesterolemic Adults J. Nutr., May 1, 2005; 135(5): 1075 - 1079. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. K. MacCallum Markers of Hemostasis and Systemic Inflammation in Heart Disease and Atherosclerosis in Smokers Proceedings of the ATS, April 1, 2005; 2(1): 34 - 43. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y Sato, K Hatakeyama, A Yamashita, K Marutsuka, A Sumiyoshi, and Y Asada Proportion of fibrin and platelets differs in thrombi on ruptured and eroded coronary atherosclerotic plaques in humans Heart, April 1, 2005; 91(4): 526 - 530. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. van Tits, J. de Graaf, H. Toenhake, W. van Heerde, and A. Stalenhoef C-Reactive Protein and Annexin A5 Bind to Distinct Sites of Negatively Charged Phospholipids Present in Oxidized Low-Density Lipoprotein Arterioscler Thromb Vasc Biol, April 1, 2005; 25(4): 717 - 722. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Boekholdt, T. T. Keller, N. J. Wareham, R. Luben, S. A. Bingham, N. E. Day, M. S. Sandhu, J. W. Jukema, J. J.P. Kastelein, C. E. Hack, et al. Serum Levels of Type II Secretory Phospholipase A2 and the Risk of Future Coronary Artery Disease in Apparently Healthy Men and Women: The EPIC-Norfolk Prospective Population Study Arterioscler Thromb Vasc Biol, April 1, 2005; 25(4): 839 - 846. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Bezzina Wettinger, C. J. M. Doggen, C. A. Spek, F. R. Rosendaal, and P. H. Reitsma High throughput mRNA profiling highlights associations between myocardial infarction and aberrant expression of inflammatory molecules in blood cells Blood, March 1, 2005; 105(5): 2000 - 2006. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Ivashchenko, F. Kramer, S. Schafer, A. Bucher, K. Veit, V. Hombach, A. Busch, O. Ritzeler, J. Dedio, and J. Torzewski Protein Kinase C Pathway Is Involved in Transcriptional Regulation of C-Reactive Protein Synthesis in Human Hepatocytes Arterioscler Thromb Vasc Biol, January 1, 2005; 25(1): 186 - 192. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J.E. Sattler, J. E. Woodrum, O. Galili, M. Olson, S. Samee, F. B. Meyer, X.-Y. Zhu, L. O. Lerman, and A. Lerman Concurrent Treatment With Renin-Angiotensin System Blockers and Acetylsalicylic Acid Reduces Nuclear Factor {kappa}B Activation and C-Reactive Protein Expression in Human Carotid Artery Plaques Stroke, January 1, 2005; 36(1): 14 - 20. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. E. Manolov, C. Rocker, V. Hombach, G. U. Nienhaus, and J. Torzewski Ultrasensitive Confocal Fluorescence Microscopy of C-Reactive Protein Interacting With Fc{gamma}RIIa Arterioscler Thromb Vasc Biol, December 1, 2004; 24(12): 2372 - 2377. [Abstract] [Full Text] [PDF] |
||||
![]() |
I B McInnes, D W McCarey, and N Sattar Do statins offer therapeutic potential in inflammatory arthritis? Ann Rheum Dis, December 1, 2004; 63(12): 1535 - 1537. [Full Text] [PDF] |
||||
![]() |
S. Black, I. Kushner, and D. Samols C-reactive Protein J. Biol. Chem., November 19, 2004; 279(47): 48487 - 48490. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. P.M. de Maat, E. M. Bladbjerg, J. von Bornemann Hjelmborg, L. Bathum, J. Jespersen, and K. Christensen Genetic Influence on Inflammation Variables in the Elderly Arterioscler Thromb Vasc Biol, November 1, 2004; 24(11): 2168 - 2173. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Okita, H. Nishijima, T. Murakami, T. Nagai, N. Morita, K. Yonezawa, K. Iizuka, H. Kawaguchi, and A. Kitabatake Can Exercise Training With Weight Loss Lower Serum C-Reactive Protein Levels? Arterioscler Thromb Vasc Biol, October 1, 2004; 24(10): 1868 - 1873. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Blaschke, D. Bruemmer, F. Yin, Y. Takata, W. Wang, M. C. Fishbein, T. Okura, J. Higaki, K. Graf, E. Fleck, et al. C-Reactive Protein Induces Apoptosis in Human Coronary Vascular Smooth Muscle Cells Circulation, August 3, 2004; 110(5): 579 - 587. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. K. Koh, M.-S. Shin, I. Sakuma, J. Y. Ahn, D. K. Jin, H. S. Kim, D. S. Kim, S. H. Han, W.-J. Chung, and E. K. Shin Effects of Conventional or Lower Doses of Hormone Replacement Therapy in Postmenopausal Women Arterioscler Thromb Vasc Biol, August 1, 2004; 24(8): 1516 - 1521. [Abstract] [Full Text] [PDF] |
||||
![]() |
F Tomai C reactive protein and microvascular function Heart, July 1, 2004; 90(7): 727 - 728. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. K. Koh and I. Sakuma Should Progestins Be Blamed for the Failure of Hormone Replacement Therapy to Reduce Cardiovascular Events in Randomized Controlled Trials? Arterioscler Thromb Vasc Biol, July 1, 2004; 24(7): 1171 - 1179. [Abstract] [Full Text] [PDF] |
||||
![]() |
D.D. Waters and K.K. Khush Management of the acute coronary syndrome patient Eur. Heart J. Suppl., July 1, 2004; 6(suppl_C): C49 - C57. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S.M. Shamsuzzaman, M. Winnicki, R. Wolk, A. Svatikova, B. G. Phillips, D. E. Davison, P. B. Berger, and V. K. Somers Independent Association Between Plasma Leptin and C-Reactive Protein in Healthy Humans Circulation, May 11, 2004; 109(18): 2181 - 2185. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Paffen, H. L. Vos, and R. M. Bertina C-Reactive Protein Does Not Directly Induce Tissue Factor in Human Monocytes Arterioscler Thromb Vasc Biol, May 1, 2004; 24(5): 975 - 981. [Abstract] [Full Text] |
||||
![]() |
T. Khreiss, L. Jozsef, L. A. Potempa, and J. G. Filep Conformational Rearrangement in C-Reactive Protein Is Required for Proinflammatory Actions on Human Endothelial Cells Circulation, April 27, 2004; 109(16): 2016 - 2022. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Bhakdi, M. Torzewski, K. Paprotka, S. Schmitt, H. Barsoom, P. Suriyaphol, S.-R. Han, K. J. Lackner, and M. Husmann Possible Protective Role for C-Reactive Protein in Atherogenesis: Complement Activation by Modified Lipoproteins Halts Before Detrimental Terminal Sequence Circulation, April 20, 2004; 109(15): 1870 - 1876. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. B. Schulze, E. B. Rimm, T. Li, N. Rifai, M. J. Stampfer, and F. B. Hu C-Reactive Protein and Incident Cardiovascular Events Among Men With Diabetes Diabetes Care, April 1, 2004; 27(4): 889 - 894. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Block, C. Jensen, M. Dietrich, E. P. Norkus, M. Hudes, and L. Packer Plasma C-Reactive Protein Concentrations in Active and Passive Smokers: Influence of Antioxidant Supplementation J. Am. Coll. Nutr., April 1, 2004; 23(2): 141 - 147. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. L. Brown, K. K. Desai, B. A. Vakili, C. Nouneh, H.-M. Lee, and L. M. Golub Clinical and Biochemical Results of the Metalloproteinase Inhibition with Subantimicrobial Doses of Doxycycline to Prevent Acute Coronary Syndromes (MIDAS) Pilot Trial Arterioscler Thromb Vasc Biol, April 1, 2004; 24(4): 733 - 738. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. O'Rourke, N. Dean, N. Akhtar, and A. Shuaib Current and future concepts in stroke prevention Can. Med. Assoc. J., March 30, 2004; 170(7): 1123 - 1133. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. V. Milani, C. J. Lavie, and M. R. Mehra Reduction in C-reactive protein through cardiac rehabilitation and exercise training J. Am. Coll. Cardiol., March 17, 2004; 43(6): 1056 - 1061. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Arroyo-Espliguero, P. Avanzas, J. Cosin-Sales, G. Aldama, C. Pizzi, and J. C. Kaski C-reactive protein elevation and disease activity in patients with coronary artery disease Eur. Heart J., March 1, 2004; 25(5): 401 - 408. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Pickup Inflammation and Activated Innate Immunity in the Pathogenesis of Type 2 Diabetes Diabetes Care, March 1, 2004; 27(3): 813 - 823. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. T. Lane Microalbuminuria as a marker of cardiovascular and renal risk in type 2 diabetes mellitus: a temporal perspective Am J Physiol Renal Physiol, March 1, 2004; 286(3): F442 - F450. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. K. Meier-Ewert, P. M. Ridker, N. Rifai, M. M. Regan, N. J. Price, D. F. Dinges, and J. M. Mullington Effect of sleep loss on C-Reactive protein, an inflammatory marker of cardiovascular risk J. Am. Coll. Cardiol., February 18, 2004; 43(4): 678 - 683. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Paul, K. W.S. Ko, L. Li, V. Yechoor, M. A. McCrory, A. J. Szalai, and L. Chan C-Reactive Protein Accelerates the Progression of Atherosclerosis in Apolipoprotein E-Deficient Mice Circulation, February 10, 2004; 109(5): 647 - 655. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Y. Hsue, K. Giri, S. Erickson, J. S. MacGregor, N. Younes, A. Shergill, and D. D. Waters Clinical Features of Acute Coronary Syndromes in Patients With Human Immunodeficiency Virus Infection Circulation, January 27, 2004; 109(3): 316 - 319. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Verma and P. E. Szmitko Coxibs and the endothelium J. Am. Coll. Cardiol., November 19, 2003; 42(10): 1754 - 1756. [Full Text] [PDF] |
||||
![]() |
P. M Ridker and on behalf of the JUPITER Study Group Rosuvastatin in the Primary Prevention of Cardiovascular Disease Among Patients With Low Levels of Low-Density Lipoprotein Cholesterol and Elevated High-Sensitivity C-Reactive Protein: Rationale and Design of the JUPITER Trial* Circulation, November 11, 2003; 108(19): 2292 - 2297. [Full Text] [PDF] |
||||
![]() |
R. Wolk, P. Berger, R. J. Lennon, E. S. Brilakis, and V. K. Somers Body Mass Index: A Risk Factor for Unstable Angina and Myocardial Infarction in Patients With Angiographically Confirmed Coronary Artery Disease Circulation, November 4, 2003; 108(18): 2206 - 2211. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Silvestro, F. Scopacasa, A. Ruocco, G. Oliva, V. Schiano, C. Zincarelli, and G. Brevetti Inflammatory status and endothelial function in asymptomatic and symptomatic peripheral arterial disease Vascular Medicine, November 1, 2003; 8(4): 225 - 232. [Abstract] [PDF] |
||||
![]() |
S. B. Schwedler, F. Guderian, J. Dammrich, L. A. Potempa, and C. Wanner Tubular staining of modified C-reactive protein in diabetic chronic kidney disease Nephrol. Dial. Transplant., November 1, 2003; 18(11): 2300 - 2307. [Abstract] [Full Text] [PDF] |
||||
![]() |
G.M. Hirschfield and M.B. Pepys C-reactive protein and cardiovascular disease: new insights from an old molecule QJM, November 1, 2003; 96(11): 793 - 807. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. J. Blake and P. M. Ridker C-reactive protein: a surrogate risk marker or mediator of atherothrombosis? Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2003; 285(5): R1250 - R1252. [Full Text] [PDF] |
||||
![]() |
S. Verma, M. R. Buchanan, and T. J. Anderson Endothelial Function Testing as a Biomarker of Vascular Disease Circulation, October 28, 2003; 108(17): 2054 - 2059. [Full Text] [PDF] |
||||
![]() |
B. OSTERUD and E. BJORKLID Role of Monocytes in Atherogenesis Physiol Rev, October 1, 2003; 83(4): 1069 - 1112. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. K. Koh, J. Y. Ahn, D. K. Jin, B.-K. Yoon, H. S. Kim, D. S. Kim, W. C. Kang, S. H. Han, I. S. Choi, and E. K. Shin Significant Differential Effects of Hormone Therapy or Tibolone on Markers of Cardiovascular Disease in Postmenopausal Women: A Randomized, Double-Blind, Placebo-Controlled, Crossover Study Arterioscler Thromb Vasc Biol, October 1, 2003; 23(10): 1889 - 1894. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. P. Miller, Y.-F. Chen, D. Xing, W. Feng, and S. Oparil Hormone Replacement Therapy and Inflammation: Interactions in Cardiovascular Disease Hypertension, October 1, 2003; 42(4): 657 - 663. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. J. Jabs, E. Theissing, M. Nitschke, J.F. M. Bechtel, M. Duchrow, S. Mohamed, B. Jahrbeck, H.-H. Sievers, J. Steinhoff, and C. Bartels Local Generation of C-Reactive Protein in Diseased Coronary Artery Venous Bypass Grafts and Normal Vascular Tissue Circulation, September 23, 2003; 108(12): 1428 - 1431. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. G. Hackam and S. S. Anand Emerging Risk Factors for Atherosclerotic Vascular Disease: A Critical Review of the Evidence JAMA, August 20, 2003; 290(7): 932 - 940. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kobayashi, N. Inoue, Y. Ohashi, M. Terashima, K. Matsui, T. Mori, H. Fujita, K. Awano, K. Kobayashi, H. Azumi, et al. Interaction of Oxidative Stress and Inflammatory Response in Coronary Plaque Instability: Important Role of C-Reactive Protein Arterioscler Thromb Vasc Biol, August 1, 2003; 23(8): 1398 - 1404. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Cao, C. Thach, T. A. Manolio, B. M. Psaty, L. H. Kuller, P. H.M. Chaves, J. F. Polak, K. Sutton-Tyrrell, D. M. Herrington, T. R. Price, et al. C-Reactive Protein, Carotid Intima-Media Thickness, and Incidence of Ischemic Stroke in the Elderly: The Cardiovascular Health Study Circulation, July 15, 2003; 108(2): 166 - 170. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-H. Wang, S.-H. Li, R. D. Weisel, P. W.M. Fedak, A. S. Dumont, P. Szmitko, R.-K. Li, D. A.G. Mickle, and S. Verma C-Reactive Protein Upregulates Angiotensin Type 1 Receptors in Vascular Smooth Muscle Circulation, April 8, 2003; 107(13): 1783 - 1790. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. W. Chan, D. L. Bhatt, D. P. Chew, J. Reginelli, J. P. Schneider, E. J. Topol, and S. G. Ellis Relation of Inflammation and Benefit of Statins After Percutaneous Coronary Interventions Circulation, April 8, 2003; 107(13): 1750 - 1756. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Hattori, M. Matsumura, and K. Kasai Vascular smooth muscle cell activation by C-reactive protein Cardiovasc Res, April 1, 2003; 58(1): 186 - 195. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. D. Sin and S.F. P. Man Why Are Patients With Chronic Obstructive Pulmonary Disease at Increased Risk of Cardiovascular Diseases?: The Potential Role of Systemic Inflammation in Chronic Obstructive Pulmonary Disease Circulation, March 25, 2003; 107(11): 1514 - 1519. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.C. Kofoed, H.H. Wittrup, H. Sillesen, and B.G. Nordestgaard Fibrinogen predicts ischaemic stroke and advanced atherosclerosis but not echolucent, rupture-prone carotid plaques: The Copenhagen City Heart Study Eur. Heart J., March 2, 2003; 24(6): 567 - 576. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. J. Blake and P. M. Ridker C-reactive protein and other inflammatory risk markers in acute coronary syndromes J. Am. Coll. Cardiol., February 19, 2003; 41(4_Suppl_S): 37S - 42S. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2001 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |