(Circulation. 2001;103:1194.)
© 2001 American Heart Association, Inc.
Brief Rapid Communications |
From Internal Medicine IICardiology, University of Ulm, Ulm, Germany.
Correspondence to Jan Torzewski, MD, MPhil, Internal Medicine II, Cardiology, University of Ulm, Robert Koch-Str 8, 89081 Ulm, Germany. E-mail jan.torzewski{at}medizin.uni-ulm.de
| Abstract |
|---|
|
|
|---|
Methods and ResultsMonocytes were isolated from human blood and transformed into macrophages. CRP/LDL uptake was assessed by immunofluorescent labeling and the use of confocal laser scanning microscopy. Native LDL coincubated with CRP was taken up by macrophages by macropinocytosis. Uptake of the CRP/LDL coincubate was mediated by the CRP receptor CD32.
ConclusionsWe conclude that foam cell formation in human atherogenesis may be caused in part by uptake of CRP-opsonized native LDL.
Key Words: lipids C-reactive protein atherosclerosis
| Introduction |
|---|
|
|
|---|
Recently, when inflammation was recognized as a major mechanism in atherosclerotic lesion formation,5 the involvement of the acute phase reactant C-reactive protein (CRP) became a matter of debate. CRP is an important cardiovascular risk factor6 7 8 9 and deposits in the arterial wall during atherogenesis, colocalizing with the terminal complement complex and foam cells.10 11 12 CRP upregulates adhesion molecule expression on endothelial cells.13 It both opsonizes biological particles14 and binds to apolipoprotein Bcontaining lipoproteins (LDL and VLDL) at their Ca2+-dependent phosphorylcholine binding sites.15 16 17 18 19 20 The major CRP-receptor on human macrophages has been identified as the low-affinity immunoglobulin receptor CD32.21 CRP-binding to CD32 is allele-specific.22
| Methods |
|---|
|
|
|---|
LDL Uptake Assay
CRP at 900 mg/L was coincubated with native LDL
(Sigma) at 1000 mg/dL in PBS containing CaCl2
(0.132 g/L) and MgCl2 (0.1 g/L) at room
temperature for 15 minutes. The supernatant was then diluted in
DMEM/10% AB-serum to a final concentration of 240 mg/L CRP and 250
mg/dL LDL. In control experiments, several lower CRP concentrations
(down to 1 mg/L) were used. Before use in the LDL uptake assay, the
CRP/LDL coincubate was again centrifuged at 15 000 rpm for 30 minutes
to remove high molecular aggregates. A dilution with heat-inactivated
10% AB-serum (56°C for 30 minutes) was used as a control for a
potential role of complement activation in our experiments. After a
further 15 minutes, the coincubate was cooled to 4°C. Substitutions
with PBS instead of CRP or LDL served as
controls.
Monocyte Isolation
Monocytes were isolated from heparinized
blood4 and adjusted with
DMEM/10% human AB serum to a density of
1.0x106 cells/mL. Cell suspensions of 50
µL per well were applied to a 4-chamber dish. Cells were cultured for
7 days at 37°C in 5%CO2 and a medium
containing 10% AB serum, which was renewed every 2 days. Macrophages
were serum-starved for 12 hours, washed with PBS (4°C), and incubated
with CRP/LDL coincubates or controls at 4°C for 30 minutes. The LDL
uptake assay was performed by incubating cells at 37°C for stated
time intervals. To block CRP-binding to CD32, control cells were
incubated with aggregated IgG at 100
µg/mL.21 Aggregated IgG
was prepared from human IgG (Sigma) by incubation at 63°C for 30
minutes at 10 mg/mL. The
phospha-tidylinositol3-kinase inhibitor
Wortmannin at 100 nmol/L, which is known to inhibit Fc
receptor-dependent ingestion, was used as an additional
control.
CD32 Polymorphism Analysis
For genetic analysis of CD32, genomic DNA was
extracted from monocytes using QIAmp-Kit (Qiagen) and subjected to
polymerase chain reaction using the following primers: sense,
5'TTGGATAGTACCTCTGAGACTG3'; antisense,
5'ACGTGAGGGCTCCAAGCTCT3'. Genotype was assessed by DNA-sequencing
of polymerase chain reaction products.
Flow Cytometry
Cells were stained for CD32 and the macrophage marker
CD14 using monoclonal FITC-conjugated anti-CD32 and
R-phycoerythrinconjugated anti-CD14, both at a 1:20-dilution
(Pharmingen). Cells were analyzed using Becton Dickinson FACSCalibur
flow cytometer with CellQuest software. Forward and side scatter was
used to gate cell population and to exclude cell debris. A minimum of
10 000 positively stained cells were analyzed. Irrelevant anti-mouse
isotype-matched antibodies were used as controls.
Immunofluorescent Staining and Analysis
Monocytes were fixed in 4% formaldehyde for 20
minutes and permeabilized by 0.5% Triton X-100. Nonspecific binding
was blocked with PBS/2% BSA. Cells were incubated with monoclonal
anti-CRP (clone 8, Sigma) at 80 µg/mL or with polyclonal goat
anti-apoB-100 (Biodesign) at 10 µg/mL. Cells were incubated with
Indodicarbocyanin-conjugated anti-mouse IgG
(Jackson-Immuno-Research) at 15 µg/mL or with
Indocarbocyanin-conjugated anti-goat antibody (Alexis) at 20 µg/mL.
Some samples were incubated with anti-CD32 FITC-conjugated mouse
monoclonal antibody (DAKO) at 10 µg/mL or TRITC or FITC-conjugated
phalloidin (Sigma), both at 0.1 mg/mL. Finally, cells were mounted in
Mowiol (Calbiochem) and visualized under confocal laser scan microscope
(63x objective; Leica).
| Results |
|---|
|
|
|---|
|
To investigate whether CD32 is involved in vesicle
formation, we analyzed CRP and CD32 staining at different time points
after incubating cells with the LDL/CRP coincubate
(Figure 2A
).
Figure 2A
shows that CRP colocalizes with clusters of CD32
on cell surfaces after 10 minutes. This figure demonstrates extensive
CRP capping on the macrophage surface, in analogy to the described
interaction of CRP with Fc-receptors on lymphoid
cells.24 With further
incubation, CRP/CD32 complexes become internalized
(Figure 2A
). The inset shows that CD32 is localized in the
vesicle wall colocalizing with CRP to the vesicle lumen. This
phenomenon does not occur after incubating cells with CRP alone (data
not shown). Flow cytometric 2-color analysis of anti-CD32 and anti-CD14
revealed a 82.23% stain for CD32 and CD14 (with a 11.91% background
stain) before incubation with CRP/LDL and a 23.63% stain for CD32 and
CD14 (with a 7.82% background) after CRP/LDL incubation.
|
Finally,
Figure 2B
shows CRP and LDL staining 60 minutes after
incubating cells with LDL/CRP coincubates. The figure demonstrates
strict colocalization of CRP and LDL in the described vesicles. Because
CRP is stained blue and LDL is stained red, vesicles containing CRP and
LDL in colocalization are violet.
Further controls included heat inactivation of AB-serum and incubation in the presence of aggregated IgG or Wortmannin (data not shown). Both heat inactivation and aggregated IgG-preincubation abolished vesicle formation and CRP/LDL uptake. Wortmannin preincubation, however, markedly reduced but did not completely abolish vesicle formation. Furthermore, lower CRP concentrations (down to 1 mg/L) revealed significant reductions in but did not completely abolish vesicle formation.
| Discussion |
|---|
|
|
|---|
Uptake of the CRP/LDL coincubate was mediated by CD32, as unequivocally demonstrated by colocalization of CRP, CD32, and LDL in the vesicles and by flow cytometric analysis showing marked reduction of anti-CD32 binding with incubation time. FcR-dependence of vesicle formation is further supported by competitive inhibition through aggregated IgG. Because CRP influences reactive oxygen production by macrophages, CRP may also facilitate LDL oxidation in the atherosclerotic lesion.25 The fact that CRP accumulates in lesions10 11 12 suggests the presence of higher CRP concentrations in atherosclerotic tissue than in serum. However, CRP concentrations in the atherosclerotic lesion, which is the location of foam cell formation, are difficult to evaluate.
In view of the well-known property of CRP to opsonize biological particles for macrophages, our finding is in line with basic functions of the immune system. In light of the increasing evidence for CRP being an important cardiovascular risk factor, we suggest that CRP-binding to LDL in the human arterial wall may link LDL deposition to the onset of arteriosclerosis.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
T. B. Grammer, W. Marz, W. Renner, B. O. Bohm, and M. M. Hoffmann C-reactive protein genotypes associated with circulating C-reactive protein but not with angiographic coronary artery disease: the LURIC study Eur. Heart J., May 21, 2008; (2008) ehn191v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Singh, M. R. Dasu, P. G. Yancey, A. Afify, S. Devaraj, and I. Jialal Human C-reactive protein promotes oxidized low density lipoprotein uptake and matrix metalloproteinase-9 release in Wistar rats J. Lipid Res., May 1, 2008; 49(5): 1015 - 1023. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. K. Singh, M. V. Suresh, D. C. Prayther, J. P. Moorman, A. E. Rusinol, and A. Agrawal C-Reactive Protein-Bound Enzymatically Modified Low-Density Lipoprotein Does Not Transform Macrophages into Foam Cells J. Immunol., March 15, 2008; 180(6): 4316 - 4322. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. R. S. Packard and P. Libby Inflammation in Atherosclerosis: From Vascular Biology to Biomarker Discovery and Risk Prediction Clin. Chem., January 1, 2008; 54(1): 24 - 38. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. Yamaleyeva, K. D. Pendergrass, N. T. Pirro, P. E. Gallagher, L. Groban, and M. C. Chappell Ovariectomy is protective against renal injury in the high-salt-fed older mRen2.Lewis rat Am J Physiol Heart Circ Physiol, October 1, 2007; 293(4): H2064 - H2071. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. N. Patel, C. A. King, S. R. Bailey, J. W. Holt, K. Venkatachalam, A. Agrawal, A. J. Valente, and B. Chandrasekar Interleukin-17 Stimulates C-reactive Protein Expression in Hepatocytes and Smooth Muscle Cells via p38 MAPK and ERK1/2-dependent NF-{kappa}B and C/EBPbeta Activation J. Biol. Chem., September 14, 2007; 282(37): 27229 - 27238. [Abstract] [Full Text] [PDF] |
||||
![]() |
D.C.Y. Yeung, A. Xu, C.W.S. Cheung, N.M.S. Wat, M.H. Yau, C.H.Y. Fong, M.T. Chau, and K.S.L. Lam Serum Adipocyte Fatty Acid-Binding Protein Levels Were Independently Associated With Carotid Atherosclerosis Arterioscler. Thromb. Vasc. Biol., August 1, 2007; 27(8): 1796 - 1802. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Ryu, C. W. Lee, J.-A. Shin, C.-S. Park, J. J. Kim, S.-J. Park, and K. H. Han Fc{gamma}RIIa mediates C-reactive protein-induced inflammatory responses of human vascular smooth muscle cells by activating NADPH oxidase 4 Cardiovasc Res, August 1, 2007; 75(3): 555 - 565. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Palmerini, A. Marzocchi, C. Marrozzini, L. B. Reggiani, C. Savini, G. Marinelli, R. Di Bartolomeo, and A. Branzi Preoperative C-reactive protein levels predict 9-month mortality after coronary artery bypass grafting surgery for the treatment of left main coronary artery stenosis Eur. J. Cardiothorac. Surg., April 1, 2007; 31(4): 685 - 690. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Rocker, D. E. Manolov, E. V. Kuzmenkina, K. Tron, H. Slatosch, J. Torzewski, and G. U. Nienhaus Affinity of C-Reactive Protein toward Fc{gamma}RI Is Strongly Enhanced by the {gamma}-Chain Am. J. Pathol., February 1, 2007; 170(2): 755 - 763. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Blaschke, Y. Takata, E. Caglayan, A. Collins, P. Tontonoz, W. A. Hsueh, and R. K. Tangirala A Nuclear Receptor Corepressor-Dependent Pathway Mediates Suppression of Cytokine-Induced C-Reactive Protein Gene Expression by Liver X Receptor Circ. Res., December 8, 2006; 99(12): e88 - e99. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Singh, S. Devaraj, M. R. Dasu, D. Ciobanu, J. Reusch, and I. Jialal C-Reactive Protein Decreases Interleukin-10 Secretion in Activated Human Monocyte-Derived Macrophages via Inhibition of Cyclic AMP Production Arterioscler. Thromb. Vasc. Biol., November 1, 2006; 26(11): 2469 - 2475. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Juonala, J. S.A. Viikari, T. Ronnemaa, L. Taittonen, J. Marniemi, and O. T. Raitakari Childhood C-Reactive Protein in Predicting CRP and Carotid Intima-Media Thickness in Adulthood: The Cardiovascular Risk in Young Finns Study Arterioscler. Thromb. Vasc. Biol., August 1, 2006; 26(8): 1883 - 1888. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Somani, P. J. Grant, K. Kain, A. J. Catto, and A. M. Carter Complement C3 and C-Reactive Protein Are Elevated in South Asians Independent of a Family History of Stroke Stroke, August 1, 2006; 37(8): 2001 - 2006. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Paffen and M. P.M. deMaat C-reactive protein in atherosclerosis: A causal factor? Cardiovasc Res, July 1, 2006; 71(1): 30 - 39. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Guven, A. Cetinkaya, M. Aral, G. Sokmen, M. A. Buyukbese, A. Guven, and N. Koksal High-Sensitivity C-Reactive Protein in Patients with Metabolic Syndrome Angiology, May 1, 2006; 57(3): 295 - 302. [Abstract] [PDF] |
||||
![]() |
M. Hermann and F. Ruschitzka Novel anti-inflammatory drugs in hypertension Nephrol. Dial. Transplant., April 1, 2006; 21(4): 859 - 864. [Full Text] [PDF] |
||||
![]() |
K M J Douglas, A V Pace, G J Treharne, A Saratzis, P Nightingale, N Erb, M J Banks, and G D Kitas Excess recurrent cardiac events in rheumatoid arthritis patients with acute coronary syndrome Ann Rheum Dis, March 1, 2006; 65(3): 348 - 353. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. J. Armstrong, D. A. Morrow, and M. S. Sabatine Inflammatory Biomarkers in Acute Coronary Syndromes: Part II: Acute-Phase Reactants and Biomarkers of Endothelial Cell Activation Circulation, February 21, 2006; 113(7): e152 - e155. [Full Text] [PDF] |
||||
![]() |
M. Can, S. Acikgoz, G. Mungan, T. Bayraktaroglu, E. Kocak, B. Guven, and S. Demirtas Serum cardiovascular risk factors in obstructive sleep apnea. Chest, February 1, 2006; 129(2): 233 - 237. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Soinio, J. Marniemi, M. Laakso, S. Lehto, and T. Ronnemaa High-Sensitivity C-Reactive Protein and Coronary Heart Disease Mortality in Patients With Type 2 Diabetes: A 7-year follow-up study Diabetes Care, February 1, 2006; 29(2): 329 - 333. [Abstract] [Full Text] [PDF] |
||||
![]() |
M Meuwissen, A C van der Wal, H W M Niessen, K T Koch, R J de Winter, C M van der Loos, S Z H Rittersma, S A J Chamuleau, J G P Tijssen, A E Becker, et al. Colocalisation of intraplaque C reactive protein, complement, oxidised low density lipoprotein, and macrophages in stable and unstable angina and acute myocardial infarction J. Clin. Pathol., February 1, 2006; 59(2): 196 - 201. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Wakugawa, Y. Kiyohara, Y. Tanizaki, M. Kubo, T. Ninomiya, J. Hata, Y. Doi, K. Okubo, Y. Oishi, K. Shikata, et al. C-Reactive Protein and Risk of First-Ever Ischemic and Hemorrhagic Stroke in a General Japanese Population: The Hisayama Study Stroke, January 1, 2006; 37(1): 27 - 32. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Y. Hsue and D. D. Waters What a Cardiologist Needs to Know About Patients With Human Immunodeficiency Virus Infection Circulation, December 20, 2005; 112(25): 3947 - 3957. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Ciubotaru, L. A. Potempa, and R. C. Wander Production of Modified C-Reactive Protein in U937-Derived Macrophages Experimental Biology and Medicine, November 1, 2005; 230(10): 762 - 770. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Torzewski C-Reactive Protein and Atherogenesis: New Insights from Established Animal Models Am. J. Pathol., October 1, 2005; 167(4): 923 - 925. [Full Text] [PDF] |
||||
![]() |
H. Sun, T. Koike, T. Ichikawa, K. Hatakeyama, M. Shiomi, B. Zhang, S. Kitajima, M. Morimoto, T. Watanabe, Y. Asada, et al. C-Reactive Protein in Atherosclerotic Lesions: Its Origin and Pathophysiological Significance Am. J. Pathol., October 1, 2005; 167(4): 1139 - 1148. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Fuster, P. R. Moreno, Z. A. Fayad, R. Corti, and J. J. Badimon Atherothrombosis and High-Risk Plaque: Part I: Evolving Concepts J. Am. Coll. Cardiol., September 20, 2005; 46(6): 937 - 954. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Trion, M.P.M. de Maat, J.W. Jukema, A. van der Laarse, M.C. Maas, E.H. Offerman, L.M. Havekes, A.J. Szalai, H.M.G. Princen, and J.J. Emeis No Effect of C-Reactive Protein on Early Atherosclerosis Development in Apolipoprotein E*3-Leiden/Human C-Reactive Protein Transgenic Mice Arterioscler. Thromb. Vasc. Biol., August 1, 2005; 25(8): 1635 - 1640. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Liu, S. Wang, A. Deb, K. A. Nath, Z. S. Katusic, J. P. McConnell, and N. M. Caplice Proapoptotic, Antimigratory, Antiproliferative, and Antiangiogenic Effects of Commercial C-Reactive Protein on Various Human Endothelial Cell Types In Vitro: Implications of Contaminating Presence of Sodium Azide in Commercial Preparation Circ. Res., July 22, 2005; 97(2): 135 - 143. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Arnaud, F. Burger, S. Steffens, N. R. Veillard, T. H. Nguyen, D. Trono, and F. Mach Statins Reduce Interleukin-6-Induced C-Reactive Protein in Human Hepatocytes: New Evidence for Direct Antiinflammatory Effects of Statins Arterioscler. Thromb. Vasc. Biol., June 1, 2005; 25(6): 1231 - 1236. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Di Napoli, M. Schwaninger, R. Cappelli, E. Ceccarelli, G. Di Gianfilippo, C. Donati, H. C.A. Emsley, S. Forconi, S. J. Hopkins, L. Masotti, et al. Evaluation of C-Reactive Protein Measurement for Assessing the Risk and Prognosis in Ischemic Stroke: A Statement for Health Care Professionals From the CRP Pooling Project Members Stroke, June 1, 2005; 36(6): 1316 - 1329. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Qamirani, Y. Ren, L. Kuo, and T. W. Hein C-Reactive Protein Inhibits Endothelium-Dependent NO-Mediated Dilation in Coronary Arterioles by Activating p38 Kinase and NAD(P)H Oxidase Arterioscler. Thromb. Vasc. Biol., May 1, 2005; 25(5): 995 - 1001. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. F. Hilpert, P. M. Kris-Etherton, and S. G. West Lipid Response to a Low-Fat Diet with or without Soy Is Modified by C-Reactive Protein Status in Moderately Hypercholesterolemic Adults J. Nutr., May 1, 2005; 135(5): 1075 - 1079. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. K. MacCallum Markers of Hemostasis and Systemic Inflammation in Heart Disease and Atherosclerosis in Smokers Proceedings of the ATS, April 1, 2005; 2(1): 34 - 43. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y Sato, K Hatakeyama, A Yamashita, K Marutsuka, A Sumiyoshi, and Y Asada Proportion of fibrin and platelets differs in thrombi on ruptured and eroded coronary atherosclerotic plaques in humans Heart, April 1, 2005; 91(4): 526 - 530. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. van Tits, J. de Graaf, H. Toenhake, W. van Heerde, and A. Stalenhoef C-Reactive Protein and Annexin A5 Bind to Distinct Sites of Negatively Charged Phospholipids Present in Oxidized Low-Density Lipoprotein Arterioscler. Thromb. Vasc. Biol., April 1, 2005; 25(4): 717 - 722. |