(Circulation. 2001;103:789.)
© 2001 American Heart Association, Inc.
Brief Rapid Communication |
Angiotensin II Blockade Reverses Myocardial Fibrosis in a Transgenic Mouse Model of Human Hypertrophic Cardiomyopathy
From the Section of Cardiology, Department of Medicine (D.-S.L., S.L., P.B., R.R., A.J.M.), and the Section of Cardiovascular Sciences and DeBakey Heart Center (K.Y., A.E., M.E.), Baylor College of Medicine, Houston, Tex.
Correspondence to A.J. Marian, MD, Associate Professor of Medicine, Section of Cardiology, One Baylor Plaza, 543E, Houston, TX 77030. E-mail amarian{at}bcm.tmc.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
Background—Hypertrophic cardiomyopathy (HCM), the most common cause of sudden cardiac death in the young, is characterized by cardiac hypertrophy, myocyte disarray, and interstitial fibrosis. We propose that hypertrophy and fibrosis are secondary to the activation of trophic and mitotic factors and, thus, potentially reversible. We determined whether the blockade of angiotensin II, a known cardiotrophic factor, could reverse or attenuate interstitial fibrosis in a transgenic mouse model of human HCM.
Methods and Results—We
randomized 24 adult cardiac troponin T
(cTnT-Q92) mice, which exhibit myocyte
disarray and interstitial fibrosis, to treatment with losartan or
placebo and included 12 nontransgenic mice as controls. The mean dose
of losartan and the mean duration of therapy were 14.2±5.3 mg ·
kg–1 · d–1
and 42±9.6 days, respectively. Mean age, number of males and females,
and heart/body weight ratio were similar in the groups. Collagen volume
fraction and extent of myocyte disarray were increased in the
cTnT-Q92 mice (placebo group) compared with
nontransgenic mice (9.9±6.8% versus 4.5±2.2%,
P=0.01, and 27.6±10.6% versus
3.9±2.3%, P<0.001,
respectively). Treatment with losartan reduced collagen volume fraction
by 49% to 4.9±2.9%. The expression of collagen 1
(I) and
transforming growth factor-
1, a mediator of angiotensin II
profibrotic effect, were also reduced by 50%. Losartan had no effect
on myocyte disarray.
Conclusions—Treatment
with losartan reversed interstitial fibrosis and the expression of
collagen 1 (I) and transforming growth factor-1 in the hearts of
cTnT-Q92 mice. These findings suggest that
losartan has the potential to reverse or attenuate interstitial
fibrosis, a major predictor of sudden cardiac death, in human patients
with HCM.
Key Words: cardiomyopathy • fibrosis • collagen • death, sudden
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Hypertrophic cardiomyopathy (HCM), the most common cause of sudden cardiac death (SCD) in the young,1 is caused by mutations in sarcomeric proteins.2 It is clinically diagnosed by unexplained cardiac hypertrophy and pathologically by myocyte hypertrophy, disarray, and interstitial fibrosis.3 Hypertrophy and fibrosis are the major determinants of mortality, morbidity, and SCD4 5 in HCM and in all acquired forms of cardiac diseases.
The genetic basis of HCM has been elucidated, and research efforts are being directed to decipher its molecular pathogenesis and to determine the reversibility of the phenotypes. We previously proposed that interstitial fibrosis, like cardiac hypertrophy, occurs "secondary" to the activation of trophic and mitotic factors in the heart6 and, thus, is potentially reversible by blocking cardiotrophic factors such as angiotensin II (Ang II). However, despite the well-established role of Ang II blockers in the attenuation of cardiac hypertrophy and fibrosis in acquired cardiac diseases, they are not conventionally used in the treatment of patients with HCM, a genetic paradigm of cardiac hypertrophy and fibrosis. We determined the effects of blocking Ang II on the interstitial collagen content of transgenic mice expressing mutant cardiac troponin T (cTnT)-Q92 protein,7 which causes HCM in humans.2
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
cTnT-Q92 Transgenic Mice Model
A full description of the cTnT-Q92 transgenic mice model has been published previously.7 In brief, the cardiac-restricted expression of cTnT-Q92 leads to myocyte disarray and interstitial fibrosis in two-thirds of 3- to 12-month-old mice but not to significant cardiac hypertrophy.7
Losartan Therapy
Age- and sex-matched adult
cTnT-Q92 mice were randomized to treatment
with either placebo (n=12) or losartan (n=12). Twelve nontransgenic
mice, matched for age and sex with the
cTnT-Q92 mice, were included as controls.
Losartan was dissolved in daily drinking water at a concentration of
0.166 mg/mL, to provide 
10 to 20 µg ·
kg–1 · d–1 of
losartan per mouse. This dose has been shown to reduce myocardial
fibrosis in a variety of experimental models without significantly
affecting blood pressure or heart
rate.8 Mice were weighed and
water consumption was measured to calculate the precise daily intake of
losartan.
Detection and Quantification of Fibrillar
Collagen
Two complementary methods of Northern blotting of
collagen 1 (I) mRNA and picrosirius red staining of collagen protein
were used. To quantify the collagen volume fraction (CVF), 5-µm-thin
ventricular sections were cut parallel to the atrioventricular groove
and stained with collagen-specific Sirius red F3BA. Morphometric
analysis was performed by an investigator who was blinded to
randomization in 10 randomly selected fields per section, in 10
sections per mouse, and in 12 mice per group in a random fashion by
computerized planimetry. Perimysial and endomysial collagens were
included, but perivascular and epimysial collagens were excluded. CVF
was calculated as the sum of all areas stained positive for Sirius red
divided by the sum of all myocardial areas in each mouse.
Expression of collagen 1 (I) mRNA, the major
collagen in the heart,9 was
detected by Northern blotting. In brief, 10-µg aliquots of cardiac
total RNA extracts were loaded onto a formaldehyde-agarose gel,
electrophoresed, and transferred to nylon membranes. A 194-bp of
fragment of the coding sequence of the
COL1A1 gene (accession number
S67530) was amplified by polymerase chain reaction (primers: forward,
5'tccctgaggtcagctgcgtac3'; reverse, 5'cgtattcttccgggcagaaag3'), labeled
with [32P]dCTP, and hybridized to
membranes in the presence of Denhardt’s reagent in hybridization
solution for 48 hours. Membranes were washed and exposed to an x-ray
film.
Detection and Quantification of Transforming
Growth Factor-1 Expression
To detect and quantify the expression of transforming
growth factor-1 (TGF-1), thin myocardial sections were incubated
with goat anti–TGF-1 polyclonal antibody at a concentration of 1
µg/mL, followed by incubation with a biotinylated anti-goat secondary
antibody, also at a concentration of 1 µg/mL. Signals were detected
by peroxidase reaction. Areas stained positive for the TGF-1
expression, excluding perivascular and epimysial areas, were quantified
in 6 fields per section, in 10 sections per mouse, and in 12 mice per
group and expressed as percent of total myocardial
area.
Detection and Quantification of Myocyte
Disarray
Myocyte disarray was detected and quantified as
previously described.7
Myocyte disarray was defined as bundles of myocytes that were aligned
perpendicularly or obliquely to each other or were interspersed in
different directions. Minor variations and areas of myocardium at the
junctions of interventricular septum with the ventricles, near the
blood vessels, and trabeculations were excluded. Extent of myocyte
disarray was quantified in 6 fields per section, in 10 sections per
mouse, and in 12 mice per group.
Statistical Methods
Differences in variables among the groups were
compared by ANOVA, followed by Bartlett’s test for the homogeneity of
variances. Variables with unequal SDs were compared by the
nonparametric Kruskal-Wallis
test.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Study Groups
No mice died during the experiments. Baseline parameters among the 3 groups, including mean age (447±69, 409±53, and 403±49.4 days in the losartan, placebo, and nontransgenic groups, respectively; P=0.31), male/female ratio (6/6 in each group), and heart weight/body weight ratio (4.1±0.5, 3.9±0.5, and 3.9±0.7 mg/g in the losartan, placebo, and nontransgenic groups, respectively; P=0.73) were not significantly different. The mean daily dose of losartan was 14.2±5.3 mg · kg–1 · d–1 (range, 8.8 to 23.6 mg · kg–1 · d–1). The mean duration of therapy was 42±9.6 days (range, 34 to 56 days).
Nontransgenic and Placebo Groups
Consistent with the previous
observations,7 the mean CVF
was increased in the cTnT-Q92 mice in the
placebo group compared with the mice in the nontransgenic group
(9.8±6.8% versus 4.5±2.2%;
P=0.028;
Figure 1A
). TGF-1 was predominantly localized to
perivascular and epimysial areas in the nontransgenic mice
(Figure 1B), whereas in the
cTnT-Q92 mice, TGF-1 was also expressed
in the perimysial and endomysial regions. As observed in human patients
with HCM,10 the expression
of TGF-1 was increased by 2-fold in the
cTnT-Q92 mice (1.1±0.38% versus
0.66±0.34% in nontransgenic mice;
P=0.008). Myocyte disarray
comprised 27.6±10.6% of the myocardium in the
cTnT-Q92 mice treated with placebo compared
with 3.9±2.3% in the nontransgenic mice
(P<0.001;
Figure 1C). There was a strong correlation between CVF and
percent of myocyte disarray (Pearson correlation, 0.81;
P=0.001) in the
cTnT-Q92 group.
|
Effects of Losartan on Cardiac
Phenotype
Losartan significantly reduced interstitial fibrillar
collagen in the cTnT-Q92 mice
(Figures 1A
and 2A). Perimysial and endomysial CVF were
reduced by 49% in the losartan group compared with the placebo group
(4.9±2.9% versus 9.8±6.8%;
P=0.040) and was similar to the
values in the nontransgenic mice. Expression of collagen 1 (I), the
predominant collagen in the
heart,9 was also reduced by
50% in the losartan group
(Figure 2B).
|
Expression of TGF-1, a known mediator of the
profibrotic effect of Ang II, was also reduced in the losartan group
compared with the placebo group (0.53±0.48% versus 1.1±0.38%,
P=0.004;
Figure 1B), and it was similar to that in the nontransgenic
mice (0.66±0.34%). The extent of myocyte disarray was not
significantly different between the losartan and placebo groups
(23.4±9.6% versus 27.6±10.6%,
P=0.32;
Figure 1C).
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
A transgenic mouse model of human HCM was established by cardiac-restricted expression of mutant cTnT-Q92 protein, which is known to cause HCM in humans.2 Adult cTnT-Q92 mice, which exhibit myocyte disarray and interstitial fibrosis,7 were matched for age and sex and treated with either losartan or placebo for 6 weeks. Interstitial fibrosis, which was detected by 2 complementary methods of Northern blotting for collagen
1 (I) mRNA and picrosirius red
staining of collagen protein, was reduced by 49% in the losartan
group. Expression of TGF-1 protein was also reduced significantly,
but the extent of myocyte disarray remained unchanged. These results in
a genetic animal model of HCM support the hypothesis that interstitial
fibrosis is a secondary and reversible phenotype. We propose that the
inhibition of Ang II in human patients with HCM, which at the present
time is considered unconventional, could have salutary effects by
attenuating fibrosis, a major risk factor for
SCD.4 We think this treatment
warrants investigation.
We performed quantitative morphometric measurements in
a blinded fashion, randomly, and in 1200 fields per group. To
corroborate the reduction of CVF with losartan, we determined the
amount of expression of collagen 1 (I) mRNA and TGF-1 protein,
which were also reduced. Our findings are also consistent with the
well-established role of Ang II blockers in the downregulation of
expression of collagen 1 (I) and TGF-1 in models of secondary
hypertrophy and
fibrosis.11 12 We
did not perform functional studies to determine whether a reduction in
interstitial fibrosis led to improvement in cardiac function or
electrophysiological properties. The anticipated effect is salutary,
through either the reversal of interstitial fibrosis or the beneficial
hemodynamic effects. The absence of functional data does not detract
from our observation that treatment with losartan reverses interstitial
fibrosis in a genetic mouse model of HCM, a finding that raises the
possibility of new therapeutic option for human HCM. The
cTnT-Q92 mice do not exhibit cardiac
hypertrophy or increased incidence of
SCD.7 Whether the blockade of
Ang II could reverse or attenuate hypertrophy or fibrosis in the
presence of hypertrophy or reduce the risk of SCD remains to be
determined. The results of recent studies in human patients with
hypertensive hypertrophic heart disease show that inhibiting Ang II
could attenuate interstitial fibrosis, which would further enhance the
potential salutary effects of Ang II blockers in
HCM.13
In summary, blocking Ang II reversed and normalized
interstitial fibrosis and reduced the expression of collagen 1 (I)
and TGF-1 in the heart of a mutant
cTnT-Q92 mouse model of HCM. These findings
support the hypothesis that interstitial fibrosis, a major predictor of
SCD in HCM,1 is a secondary
phenotype that could be reversed. We propose that inhibiting Ang II in
human patients with HCM (the most common cause of SCD in the
young1 ), which at the present
time is considered unconventional, could have salutary effects and
warrants
investigation.
|
Acknowledgments |
|---|
Supported by grants from the National Heart, Lung, and Blood Institute, Specialized Centers of Research (P50-HL42267 to 01), and an Established Investigator Award (9640133N) from the American Heart Association, National Center, Dallas, Texas.
|
Footnotes |
|---|
Guest Editor for this article was Christine E. Seidman, MD, Harvard Medical School, Boston, Mass.
Received September 26, 2000; revision received November 29, 2000; accepted December 28, 2000.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
1. Maron BJ, Shirani J, Poliac LC, et al. Sudden death in young competitive athletes: Clinical, demographic, and pathological profiles. JAMA. 1996;276:199–204.
2. Seidman CE, Seidman JG. Molecular genetic studies of familial hypertrophic cardiomyopathy. Basic Res Cardiol. 1998;93(suppl 3):13–16.
3.
Maron BJ,
Roberts WC. Quantitative analysis of cardiac muscle cell
disorganization in the ventricular septum of patients with hypertrophic
cardiomyopathy. Circulation. 1979;59:689–706.
4.
Shirani J,
Pick R, Roberts WC, et al. Morphology and significance of the left
ventricular collagen network in young patients with hypertrophic
cardiomyopathy and sudden cardiac death.
J Am Coll Cardiol. 2000;35:36–44.
5.
Spirito P,
Bellone P, Harris KM, et al. Magnitude of left ventricular hypertrophy
and risk of sudden death in hypertrophic cardiomyopathy.
N Engl J Med. 2000;342:1778–1785.
6. Marian AJ. Pathogenesis of diverse clinical and pathological phenotypes in hypertrophic cardiomyopathy. Lancet. 2000;355:58–60.[Medline] [Order article via Infotrieve]
7. Oberst L, Zhao G, Park JT, et al. Dominant-negative effect of a mutant cardiac troponin T on cardiac structure and function in transgenic mice. J Clin Invest. 1998;102:1498–1505.[Medline] [Order article via Infotrieve]
8. Melo LG, Veress AT, Chong CK, et al. Salt-sensitive hypertension in ANP knockout mice is prevented by AT1 receptor antagonist losartan. Am J Physiol. 1999;277:R624–R630.
9.
Weber KT.
Targeting pathological remodeling: concepts of cardioprotection and
reparation. Circulation. 2000;102:1342–1345.
10.
Li RK, Li
G, Mickle DA, et al. Overexpression of transforming growth factor-beta1
and insulin-like growth factor-I in patients with idiopathic
hypertrophic cardiomyopathy.
Circulation. 1997;96:874–881.
11.
Tomita H,
Egashira K, Ohara Y, et al. Early induction of transforming growth
factor-beta via angiotensin II type 1 receptors contributes to cardiac
fibrosis induced by long-term blockade of nitric oxide synthesis in
rats. Hypertension. 1998;32:273–279.
12.
Kawano H,
Do YS, Kawano Y, et al. Angiotensin II has multiple profibrotic effects
in human cardiac fibroblasts.
Circulation. 2000;101:1130–1137.
13.
Brilla CG,
Funck RC, Rupp H. Lisinopril-mediated regression of myocardial fibrosis
in patients with hypertensive heart disease.
Circulation. 2000;102:1388–1393.
This article has been cited by other articles:
 |
|
 |
|
  M. S. Maron, I. Olivotto, B. J. Maron, S. K. Prasad, F. Cecchi, J. E. Udelson, and P. G. Camici The case for myocardial ischemia in hypertrophic cardiomyopathy. J. Am. Coll. Cardiol., August 25, 2009; 54(9): 866 - 875. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. Bos, J. A. Towbin, and M. J. Ackerman Diagnostic, prognostic, and therapeutic implications of genetic testing for hypertrophic cardiomyopathy. J. Am. Coll. Cardiol., July 14, 2009; 54(3): 201 - 211. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. De Backer The expanding cardiovascular phenotype of Marfan syndrome Eur J Echocardiogr, March 1, 2009; 10(2): 213 - 215. [Full Text] [PDF]
|
|
|
|
 |
|
 F. Cambronero, F. Marin, V. Roldan, D. Hernandez-Romero, M. Valdes, and G. Y.H. Lip Biomarkers of pathophysiology in hypertrophic cardiomyopathy: implications for clinical management and prognosis Eur. Heart J., January 9, 2009; (2009) ehn538v1. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Penicka, P. Gregor, R. Kerekes, D. Marek, K. Curila, J. Krupicka, and for the Candesartan use in Hypertrophic And Non-ob The Effects of Candesartan on Left Ventricular Hypertrophy and Function in Nonobstructive Hypertrophic Cardiomyopathy: A Pilot, Randomized Study J. Mol. Diagn., January 1, 2009; 11(1): 35 - 41. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. S. Bedair, T. Karthikeyan, A. Quintero, Y. Li, and J. Huard Angiotensin II Receptor Blockade Administered After Injury Improves Muscle Regeneration and Decreases Fibrosis in Normal Skeletal Muscle Am. J. Sports Med., August 1, 2008; 36(8): 1548 - 1554. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Lombardi, A. Bell, V. Senthil, J. Sidhu, M. Noseda, R. Roberts, and A. J. Marian Differential interactions of thin filament proteins in two cardiac troponin T mouse models of hypertrophic and dilated cardiomyopathies Cardiovasc Res, July 1, 2008; 79(1): 109 - 117. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. S. Brooke, J. P. Habashi, D. P. Judge, N. Patel, B. Loeys, and H. C. Dietz III Angiotensin II Blockade and Aortic-Root Dilation in Marfan's Syndrome N. Engl. J. Med., June 26, 2008; 358(26): 2787 - 2795. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Dandona and R. Roberts Identification of Myofilament Mutations: Its Role in the Diagnosis and Management of Hypertrophic Cardiomyopathy Mayo Clin. Proc., June 1, 2008; 83(6): 626 - 627. [Full Text] [PDF]
|
|
|
|
 |
|
 A Williams, S Davies, A G Stuart, D G Wilson, and A G Fraser Medical treatment of Marfan syndrome: a time for change Heart, April 1, 2008; 94(4): 414 - 421. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Matt, J. Habashi, T. Carrel, D. E. Cameron, J. E. Van Eyk, and H. C. Dietz Recent advances in understanding Marfan syndrome: should we now treat surgical patients with losartan? J. Thorac. Cardiovasc. Surg., February 1, 2008; 135(2): 389 - 394. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Pannu, V. Tran-Fadulu, C. L. Papke, S. Scherer, Y. Liu, C. Presley, D. Guo, A. L. Estrera, H. J. Safi, A. R. Brasier, et al. MYH11 mutations result in a distinct vascular pathology driven by insulin-like growth factor 1 and angiotensin II Hum. Mol. Genet., October 15, 2007; 16(20): 2453 - 2462. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J.P. Habashi, D.P. Judge, T.M. Holm, R.D Cohn, B. Loeys, T.K. Cooper, L. Myers, E.C. Klein, G. Liu, C. Calvi, et al. Losartan in Marfan Syndrome--Beyond Blood Pressure Lowering: Losartan, an AT1 Antagonist, Prevents Aortic Aneurysm in a Mouse Model of Marfan Syndrome. Science 312: 117-121, 2006 J. Am. Soc. Nephrol., July 1, 2006; 17(7): 1759 - 1764. [Full Text] [PDF]
|
|
|
|
 |
|
 C. Y. Ho and C. E. Seidman A Contemporary Approach to Hypertrophic Cardiomyopathy Circulation, June 20, 2006; 113(24): e858 - e862. [Full Text] [PDF]
|
|
|
|
 |
|
 H. Milting, A. Kassner, L. Arusoglu, H. E. Meyer, M. Morshuis, R. Brendel, B. Klauke, A. El Banayosy, and R. Korfer Influence of ACE-inhibition and mechanical unloading on the regulation of extracellular matrix proteins in the myocardium of heart transplantation candidates bridged by ventricular assist devices Eur J Heart Fail, May 1, 2006; 8(3): 278 - 283. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. P. Habashi, D. P. Judge, T. M. Holm, R. D. Cohn, B. L. Loeys, T. K. Cooper, L. Myers, E. C. Klein, G. Liu, C. Calvi, et al. Losartan, an AT1 antagonist, prevents aortic aneurysm in a mouse model of Marfan syndrome. Science, April 7, 2006; 312(5770): 117 - 121. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Voros, Z. Yang, C. M. Bove, W. D. Gilson, F. H. Epstein, B. A. French, S. S. Berr, S. P. Bishop, M. R. Conaway, H. Matsubara, et al. Interaction between AT1 and AT2 receptors during postinfarction left ventricular remodeling Am J Physiol Heart Circ Physiol, March 1, 2006; 290(3): H1004 - H1010. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. J. Marian, V. Senthil, S. N. Chen, and R. Lombardi Antifibrotic Effects of Antioxidant N-Acetylcysteine in a Mouse Model of Human Hypertrophic Cardiomyopathy Mutation J. Am. Coll. Cardiol., February 21, 2006; 47(4): 827 - 834. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. D. Binder, M. A. Fifer, M. E. King, and J. R. Stone Case 26-2005 - A 48-Year-Old Man with Sudden Loss of Consciousness while Jogging N. Engl. J. Med., August 25, 2005; 353(8): 824 - 832. [Full Text] [PDF]
|
|
|
|
|
|
J. De Backer, D. Matthys, T.C. Gillebert, A. De Paepe, and J. De Sutter The use of Tissue Doppler Imaging for the assessment of changes in myocardial structure and function in inherited cardiomyopathies Eur J Echocardiogr, August 1, 2005; 6(4): 243 - 250. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Roberts and U. Sigwart Current Concepts of the Pathogenesis and Treatment of Hypertrophic Cardiomyopathy Circulation, July 12, 2005; 112(2): 293 - 296. [Full Text] [PDF]
|
|
|
|
|
|
S. Lutucuta, N. Tsybouleva, M. Ishiyama, G. DeFreitas, L. Wei, B. Carabello, and A.J. Marian Induction and reversal of cardiac phenotype of human hypertrophic cardiomyopathy mutation cardiac troponin T-Q92 in switch on-switch off bigenic mice J. Am. Coll. Cardiol., December 7, 2004; 44(11): 2221 - 2230. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Hanna, S. Cardin, T.-K. Leung, and S. Nattel Differences in atrial versus ventricular remodeling in dogs with ventricular tachypacing-induced congestive heart failure Cardiovasc Res, August 1, 2004; 63(2): 236 - 244. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Tsybouleva, L. Zhang, S. Chen, R. Patel, S. Lutucuta, S. Nemoto, G. DeFreitas, M. Entman, B. A. Carabello, R. Roberts, et al. Aldosterone, Through Novel Signaling Proteins, Is a Fundamental Molecular Bridge Between the Genetic Defect and the Cardiac Phenotype of Hypertrophic Cardiomyopathy Circulation, March 16, 2004; 109(10): 1284 - 1291. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Peng, O. A. Carretero, D. R. Brigstock, N. Oja-Tebbe, and N.-E. Rhaleb Ac-SDKP Reverses Cardiac Fibrosis in Rats With Renovascular Hypertension Hypertension, December 1, 2003; 42(6): 1164 - 1170. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. J. Maron, W. J. McKenna, G. K. Danielson, L. J. Kappenberger, H. J. Kuhn, C. E. Seidman, P. M. Shah, W. H. Spencer III, P. Spirito, F. J. Ten Cate, et al. American College of Cardiology/European Society of Cardiology Clinical Expert Consensus Document on Hypertrophic Cardiomyopathy: a report of the American College of Cardiology Foundation Task Force on Clinical Expert Consensus Documents and the European Society of Cardiology Committee for Practice Guidelines J. Am. Coll. Cardiol., November 5, 2003; 42(9): 1687 - 1713. [Full Text] [PDF]
|
|
|
|
|
|
Writing Committee Members, B. J. Maron, W. J. McKenna, G. K. Danielson, L. J. Kappenberger, H. J. Kuhn, C. E. Seidman, P. M. Shah, W. H. Spencer III, P. Spirito, et al. American College of Cardiology/European Society of Cardiology Clinical Expert Consensus Document on Hypertrophic Cardiomyopathy: A report of the American College of Cardiology Foundation Task Force on Clinical Expert Consensus Documents and the European Society of Cardiology Committee for Practice Guidelines Eur. Heart J., November 1, 2003; 24(21): 1965 - 1991. [Full Text] [PDF]
|
|
|
|
|
|
R. Lombardi, S. Betocchi, M. A. Losi, C. G. Tocchetti, M. Aversa, M. Miranda, G. D'Alessandro, A. Cacace;, Q. Ciampi, and M. Chiariello Myocardial Collagen Turnover in Hypertrophic Cardiomyopathy Circulation, September 23, 2003; 108(12): 1455 - 1460. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Flesch, A. Hoper, L. Dell'Italia, K. Evans, R. Bond, R. Peshock, A. Diwan, T. A. Brinsa, C.-C. Wei, N. Sivasubramanian, et al. Activation and Functional Significance of the Renin-Angiotensin System in Mice With Cardiac Restricted Overexpression of Tumor Necrosis Factor Circulation, August 5, 2003; 108(5): 598 - 604. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. F. Nagueh, J. McFalls, D. Meyer, R. Hill, W. A. Zoghbi, J. W. Tam, M. A. Quinones, R. Roberts, and A.J. Marian Tissue Doppler Imaging Predicts the Development of Hypertrophic Cardiomyopathy in Subjects With Subclinical Disease Circulation, July 29, 2003; 108(4): 395 - 398. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A.J. Marian and R. Roberts To Screen or Not Is Not the Question-- It Is When and How to Screen Circulation, May 6, 2003; 107(17): 2171 - 2174. [Full Text] [PDF]
|
|
|
|
|
|
A. J. Marian On predictors of sudden cardiac death in hypertrophic cardiomyopathy J. Am. Coll. Cardiol., March 19, 2003; 41(6): 994 - 996. [Full Text] [PDF]
|
|
|
|
|
|
P. C. Brum, J. Kosek, A. Patterson, D. Bernstein, and B. Kobilka Abnormal cardiac function associated with sympathetic nervous system hyperactivity in mice Am J Physiol Heart Circ Physiol, November 1, 2002; 283(5): H1838 - H1845. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Arad, J.G. Seidman, and C. E. Seidman Phenotypic diversity in hypertrophic cardiomyopathy Hum. Mol. Genet., October 1, 2002; 11(20): 2499 - 2506. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Braunwald, C. E. Seidman, and U. Sigwart Contemporary Evaluation and Management of Hypertrophic Cardiomyopathy Circulation, September 10, 2002; 106(11): 1312 - 1316. [Full Text] [PDF]
|
|
|
|
|
|
R. Roberts Disrobing the Emperor (Heart) Without Destroying the Dignity of Super-Normality Circulation, June 25, 2002; 105(25): 2934 - 2936. [Full Text] [PDF]
|
|
|
|
 |
|
 B. J. Maron Hypertrophic Cardiomyopathy: A Systematic Review JAMA, March 13, 2002; 287(10): 1308 - 1320. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Deinum, J. M.G. van Gool, M. J.M. Kofflard, F. J. ten Cate, and A.H. J. Danser Angiotensin II Type 2 Receptors and Cardiac Hypertrophy in Women With Hypertrophic Cardiomyopathy Hypertension, December 1, 2001; 38(6): 1278 - 1281. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Li, G. Z. Czernuszewicz, O. Gonzalez, T. Tapscott, A. Karibe, J.-B. Durand, R. Brugada, R. Hill, J. M. Gregoritch, J. L. Anderson, et al. Novel Cardiac Troponin T Mutation as a Cause of Familial Dilated Cardiomyopathy Circulation, October 30, 2001; 104(18): 2188 - 2193. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Roberts and U. Sigwart New Concepts in Hypertrophic Cardiomyopathies, Part II Circulation, October 30, 2001; 104(18): 2249 - 2252. [Full Text] [PDF]
|
|
|
|
|
|
R. Patel, S. F. Nagueh, N. Tsybouleva, M. Abdellatif, S. Lutucuta, H. A. Kopelen, M. A. Quinones, W. A. Zoghbi, M. L. Entman, R. Roberts, et al. Simvastatin Induces Regression of Cardiac Hypertrophy and Fibrosis and Improves Cardiac Function in a Transgenic Rabbit Model of Human Hypertrophic Cardiomyopathy Circulation, July 17, 2001; 104(3): 317 - 324. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. F. Nagueh, L. L. Bachinski, D. Meyer, R. Hill, W. A. Zoghbi, J. W. Tam, M. A. Quinones, R. Roberts, and A.J. Marian Tissue Doppler Imaging Consistently Detects Myocardial Abnormalities in Patients With Hypertrophic Cardiomyopathy and Provides a Novel Means for an Early Diagnosis Before and Independently of Hypertrophy Circulation, July 10, 2001; 104(2): 128 - 130. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||