| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
(Circulation. 2001;103:319.)
© 2001 American Heart Association, Inc.
Basic Science Reports |
Myocardial Fibrosis in DOCA-Salt Hypertensive Rats
Effect of Endothelin ETA Receptor Antagonism
From the Multidisciplinary Research Group on Hypertension, Clinical Research Institute of Montreal, Montréal, Québec, Canada.
Correspondence to Ernesto L. Schiffrin, MD, PhD, FRCPC, Clinical Research Institute of Montreal, 110, Avenue des Pins Ouest, Montréal, Québec, Canada H2W 1R7. E-mail schiffe{at}IRCM.qc.ca
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
Background—To test the hypothesis that endothelin-1 contributes to cardiac fibrosis, cardiac collagen deposition was studied in deoxycorticosterone acetate–salt (DOCA-salt) hypertensive rats, in which the endothelin system is activated. The effects of the ETA-selective endothelin receptor antagonist A-127722 were evaluated.
Methods and Results—A-127722 (30 mg/kg per day) was administered for 4 weeks. Myocardial fibrosis was evaluated after Sirius red F3BA staining. Systolic blood pressure was 103±1.6 mm Hg in unilaterally nephrectomized rats (Uni-Nx), 202±3.2 mm Hg in DOCA-salt rats (P<0.01 versus Uni-Nx), and 182±3.1 mm Hg in ETA antagonist–treated DOCA-salt rats (P<0.01 versus DOCA-salt or Uni-Nx). In DOCA-salt rats, interstitial and perivascular collagen density was increased in the subendocardial and midmyocardial regions of the left ventricle (3- to 4-fold, P<0.05), whereas in subepicardial myocardium, the increase was predominantly perivascular. The ETA antagonist prevented cardiac fibrosis in DOCA-salt rats. Procollagen I and III mRNA, which were increased in hearts of DOCA-salt rats, were normalized by ETA antagonist treatment. TGF-ß1 mRNA and TGF-ß1 protein increased at 1 week in DOCA-salt rats and were lowered in ETA antagonist–treated rats.
Conclusions—ETA receptor–mediated collagen deposition in hearts of DOCA-salt rats results from increased procollagen synthesis associated with an initial increment in expression of TGF-ß1. These results support the hypothesis of a role for endothelin-1 in cardiac collagen deposition in mineralocorticoid hypertension, which may have pathophysiological and pharmacological implications in hypertensive heart disease.
Key Words: collagen • myocardium • growth substances
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Cardiac remodeling in hypertension is characterized by increased cardiomyocyte volume and collagen deposition.1 2 Deposition of collagen (specifically types I and III) in the myocardial interstitium and around coronary arteries has been demonstrated in renovascular hypertension, after angiotensin II or aldosterone infusion, and in aging spontaneously hypertensive rats.3 4 5 6 Collagens I and III are synthesized by interstitial and pericoronary fibroblasts.7 Cardiac fibroblast activity is regulated by various factors, including hemodynamic (coronary perfusion, ventricular overload) and humoral (aldosterone and angiotensin II) factors.4 8 9
Involvement of endothelin-1 (ET-1) in hypertensive models such as deoxycorticosterone acetate (DOCA)–salt hypertension has been suggested by vascular overexpression of ET-110 11 and blood pressure reduction in response to endothelin antagonists.12 ET-1 promotes growth of cardiomyocytes in vitro,13 14 15 16 induces collagen synthesis by cardiac fibroblasts,16 17 and has been shown to influence development of left ventricular hypertrophy.18 19 In DOCA-salt hypertension, ET-1 is overexpressed in the heart, although overexpression appears to be limited to endothelial cells and the endocardium.20
The aim of this study was to analyze (1) the effects of DOCA-salt hypertension on cardiac collagen deposition and (2) the effects of the ETA-selective endothelin antagonist A-127722 on collagen density in this model, in which ET-1 plays a role.21 We tested the hypothesis that ET-1 stimulates myocardial collagen deposition in DOCA-salt hypertensive rats via the activation of ETA-receptors. We also evaluated whether changes in collagen deposition reflect changes in collagen synthesis, and the potential role of TGF-ß1 in our findings. The blood pressure and vascular effects of A-127722 in these DOCA-salt rats were previously published by us22 and will be mentioned only briefly.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Animal Experiments
The study was approved by the Animal Care Committee of the Clinical Research Institute of Montreal and conducted in accordance with recommendations of the Canadian Council of Animal Care. DOCA-salt hypertension was induced by the method of Ormsbee and Ryan,23 as already described.21 Male Sprague Dawley rats (Charles River, St Constant, Québec, Canada) weighing 200 g were unilaterally nephrectomized (Uni-Nx) under sodium pentobarbital anesthesia (40 mg/kg). Silicone rubber impregnated with DOCA (Sigma Chemical Co) (200 mg per rat) was implanted subcutaneously, and rats were offered 1% saline to drink. Control rats also underwent Uni-Nx but received a silicone rubber implant without DOCA and tap water to drink. The ETA endothelin receptor antagonist A-127722 was administered in the drinking water (30 mg/kg per day) for 4 weeks. Systolic blood pressure was measured weekly by the tail-cuff method with the rats under slight restraint after they had been warmed. Readings were recorded on a model 7 polygraph fitted with a 7-P8 preamplifier and PCPB photoelectric pulse sensor (all from Grass Instruments Co). The average of 3 pressure readings was obtained. Rats were killed by decapitation at the end of the experiment, and the heart was fixed in Bouin’s solution. To study the time course of some of the changes, additional groups of DOCA-salt rats and ETA antagonist–treated DOCA-salt rats were investigated at 1 and 2 weeks of DOCA and salt administration.
Collagen Quantification
The hearts fixed in Bouin’s solution were processed
for paraffin embedding in an automated system (Shandon Citadel tissue
processor). Serial sections (5 µm) of the median part of the left
ventricle were obtained. Tissue sections were dewaxed with ethanol and
stained with Sirius red F3BA (0.5% in saturated aqueous picric acid)
(Aldrich Chemical Co). Collagen density was evaluated throughout the
inner third (subendocardial myocardium), the middle third
(midmyocardium), and the outer third (subepicardial myocardium) of the
circumference of the left ventricle. From each of 3 nonconsecutive
serial sections (which allowed convergence of results), 10 fields in
each region of the heart (magnification x20) were recorded. The
severity of cardiac fibrosis was evaluated after Sirius red staining
with the use of an image analysis system (Northern Eclipse 5.0, EMPIX
Imaging Inc). A single investigator blinded to the experimental groups
performed the analysis.
Reverse Transcription–Polymerase Chain
Reaction Analysis of Procollagen I and III mRNA
Total RNA was extracted from the left ventricle with
Trizol reagent (Gibco-BRL). mRNA (0.5 µg) was reverse transcribed in
a final volume of 20 µL with MMLV reverse transcriptase (Gibco-BRL)
and 1 µg oligo(dt) primer. Single-strand cDNA (4 µL) was used for
polymerase chain reaction (PCR) to amplify a 405-bp fragment of
pro
1(I)collagen (procollagen I) cDNA with the complementary
antisense primer GTTTACAGGAAGCAGACAGG and the sense primer
CGATGGATTCCAGTTCGAGTA at an annealing temperature of 56°C. For a
447-bp fragment of pro1(III)collagen (procollagen III) cDNA, the
antisense primer was CCATCCTCTAGAACTGTGTAAGTG, the sense primer
CCACCCTGAACTCAAGAGTGG, and the annealing temperature 58°C. For a
290-bp fragment of TGF-ß1 cDNA, the antisense
primer was CAACGCCATCTATGAGAAAACC, the sense primer
AAGCCCTGTATTCCGTCTCC, and the annealing temperature 52°C. For a
192-bp fragment of the housekeeping gene GAPDH cDNA, the antisense
primer was ATGTCGTTGTCCCACCAC, the sense primer TATGATGACATCAAGAAGGTGG,
and the annealing temperature 56°C. PCR was performed with Taq
polymerase (Gibco-BRL) for 22 cycles for procollagens and 30 cycles for
TGF-ß1 and GAPDH. Reverse transcription
(RT)-PCR products were subjected to electrophoresis on a 1.5% agarose
gel, and ethidium bromide–stained bands were analyzed
densitometrically.
Western Blot Analysis of
TGF-ß1 Protein
Protein was extracted from frozen tissue in lysis
buffer containing PBS, sodium deoxycholate 0.5%, SDS 0.1%, sodium
orthovanadate 1 mmol/L, PMSF 1.0 mmol/L, Nonidet-P40 1%, and aprotinin
1 µg/mL. Protein concentration was determined with the BioRad protein
assay (Bio-Rad Laboratories Inc). TGF-ß1 was
immunoprecipitated from 2 mg protein with a specific antibody (Santa
Cruz Biotechnology Inc) at a dilution of 1:200. Samples were
electrophoresed in a 10% SDS-polyacrylamide gel at 60 V for 2 hours
and transferred onto a PVDF membrane at 100 V for 1 hour. Membranes
were incubated with the specific antibodies to
TGF-ß1 at a dilution of 1:1000 overnight at
4°C. Horseradish peroxidase–conjugated rabbit IgG (1/5000, from
Santa Cruz Biotechnology) was used as second antibody. Bands were
visualized by chemiluminescence (kit from Boehringer Mannheim) and
quantified by densitometry.
Statistical Analysis
The means of collagen density from 3 sections of each
area of each heart were evaluated. Results are expressed as mean±SEM.
Statistical significance was assessed by 1-way ANOVA followed by a
Student-Newman-Keuls test. Differences were considered significant at a
value of
P<0.05.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Blood Pressure and Body and Heart Weights of Rats
As already reported,22 the systolic blood pressure of DOCA-salt hypertensive rats was significantly elevated after 4 weeks (Table 1
). Treatment with A-127722 resulted in
slightly but significantly lower blood pressure in DOCA-salt
hypertensive rats than in untreated DOCA-salt rats. Body weight of
DOCA-salt hypertensive rats was significantly lower than that of
normotensive control rats, as we have found in previous
studies.10 12
Relative heart weights were similar in treated and untreated DOCA-salt
hypertensive rats and higher than in normotensive
rats.
|
Effects of Endothelin Antagonist on
Collagen Deposition
There was a dramatic increase in interstitial and
perivascular myocardial collagen in the subendocardial and
midmyocardial regions of the left ventricle of DOCA-salt rats compared
with Uni-Nx controls
(Figures 1 and 2). In the subepicardial myocardium, in
contrast, collagen density was increased predominantly around blood
vessels. Treatment with A-127722 prevented collagen deposition in the
left ventricle of DOCA-salt rats.
|
|
Expression of Procollagen Type I and III mRNA
and TGF-ß1 mRNA and Protein
Figure 3 shows that in DOCA-salt rats, levels of procollagen
type I and III mRNA in the left ventricle were 1.6-fold higher than in
Uni-Nx rats (P<0.01). In
DOCA-salt rats treated with the ETA-receptor
antagonist, levels of procollagen I and III mRNA were similar to basal
levels.
|
In DOCA-salt rats, there was a trend toward an increase in
TGF-ß1 mRNA at 1 week that did not achieve
significance, whereas in ETA antagonist–treated
rats, there was a significant decrease compared with DOCA-salt rats
(P<0.05,
Figure 4). No change in TGF-ß1 mRNA
levels could be demonstrated in the heart of any of the groups
investigated at 2 and 4 weeks
(Table 2). TGF-ß1 protein was
expressed in the left ventricle as the 55-kDa full-length precursor, as
previously shown by
others.24 In hearts of
DOCA-salt rats after 1 week of hypertension,
TGF-ß1 protein levels were 2.5-fold higher
than in hearts of control rats
(Figure 5). In ETA
antagonist–treated rats, cardiac TGF-ß1
protein was significantly lower than in DOCA-salt rats. In the second
and fourth weeks of hypertension, no statistically significant
elevation was detectable in DOCA-salt hypertensive rats
(Table 2).
|
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
The present study investigated collagen deposition and its mechanism in the heart of DOCA-salt hypertensive rats and the role that ET-1 may play in cardiac fibrosis in this model of hypertension. In this model, which has an endothelin-dependent component,10 11 12 21 22 collagen deposition was dramatically increased interstitially and perivascularly in subendocardial and midmyocardial areas of the left ventricle, but predominantly around blood vessels in the subepicardium. Although development of left ventricular hypertrophy was unaffected by the ETA-selective antagonist A-127722, cardiac collagen deposition was dramatically reduced. In association with this, procollagen I and III mRNAs were increased in DOCA-salt rat hearts, a rise that was abrogated by the ETA antagonist. In the first week, cardiac TGF-ß1 expression was increased in DOCA-salt rats and was significantly decreased by the ETA antagonist. These data suggest a critical role of the activated endothelin system in cardiac fibrosis in mineralocorticoid hypertension, resulting from increased collagen synthesis via an ET-1–induced TGF-ß1–dependent component.
Effect of ET-1 on Cardiac Collagen Versus Left
Ventricular Hypertrophy
The potential involvement of ET-1 in some models of
experimental hypertension, such as DOCA-salt hypertension, has been
well
demonstrated.10 11 12 21 22
In the heart, ET-1 overexpression occurred mainly in the endothelium of
blood vessels in DOCA-salt hypertensive
rats.20 ET-1 produced in
blood vessels of the heart may stimulate interstitial fibroblasts to
produce
collagen16 17 but
could conceivably have only minor effects on cardiomyocytes. Blood
pressure was lowered only moderately in endothelin antagonist–treated
rats. More effective blood pressure lowering may be necessary to have a
significant effect on cardiac hypertrophy, as discussed below.
Alternatively, development of left ventricular hypertrophy and cardiac
fibrosis may obey different determinants. Whereas blood pressure
elevation may be critical for development of cardiac hypertrophy, it
may have less influence on collagen deposition. Cardiac fibrosis may
result in this experimental paradigm, mainly from stimulation of
cardiac interstitial fibroblasts by ET-1, whereas left ventricular
hypertrophy may develop in the absence of ET-1 stimulation if blood
pressure remains elevated, as it did despite ETA
antagonism in the present study. Similar findings have been reported
recently in this same model when the rats were treated with inhibitors
of the renin-angiotensin system: reversal of cardiac fibrosis without
change in cardiac
hypertrophy.25
Relationship of Cardiac Fibrosis and Left
Ventricular Hypertrophy
Cardiac hypertrophy does not necessarily translate into
increased collagen deposition. Collagen content is increased in
pressure-induced hypertrophy in animal
models26 27 and
in humans.28 However, volume
overload in rats29 or
humans30 induces hypertrophy
in the absence of changes in collagen deposition. Pathophysiological
conditions that cause synthesis and accumulation of collagen can thus
be dissociated from conditions that activate cardiomyocyte hypertrophy.
Indeed, in the present study, we found that endothelin antagonism
completely abrogated the increase in collagen content in the hearts of
DOCA-salt rats but did not significantly affect cardiac hypertrophy.
Cardiac hypertrophy in DOCA-salt rats may have a component associated
with collagen deposition via endothelin-mediated
mechanisms16 17
and one independent of both collagen deposition and ET-1
stimulation.
Localization of Collagen Deposition in the
Heart
ET-1–dependent fibrosis occurred in DOCA-salt
hypertensive rats predominantly interstitially and perivascularly in
the midmyocardial and subendocardial regions of the left ventricle and
predominantly perivascularly in the subepicardium. The distribution of
increased interstitial collagen is strikingly similar to the
localization of changes in arterioles and capillaries in the DOCA-salt
hypertensive rat as an expression of ET-1–mediated effects. Increased
density of small arterioles 20 µm in lumen diameter and capillary
rarefaction were found mainly in the subendocardial myocardium of
DOCA-salt hypertensive rats, which was corrected by treatment with an
ETA
antagonist.31 There may be a
common mechanism for cardiac fibrosis and vascular abnormalities in
DOCA-salt rats: They both appear to be a consequence of vascular
overproduction of ET-1. Increased arteriolar density could lead to
increased coronary resistance through lengthening of arteriolar
segments. Decreased capillary density together with fibrosis may
compromise oxygen and nutrient supply to cardiac myocytes, contributing
to hypoxia in this more vulnerable area of the
myocardium.32 33
Hemodynamic (including pressure) and metabolic variables probably
participate, together with ET-1 and presumably other hormonal stimuli,
to induce vascular growth and rarefaction in this region of the heart
of DOCA-salt hypertensive rats, whereas ET-1 appears to play a
fundamental role in fibrosis, as shown by its prevention under
ETA receptor blockade.
Synthesis of Collagen Explains Increased
Collagen Deposition in DOCA-Salt Rats
Expression of procollagen I and III mRNA in the heart
of DOCA-salt rats was increased compared with control rats, indicating
enhanced collagen synthesis. ETA-receptor
antagonist treatment blunted collagen overexpression, suggesting that
increased collagen synthesis was mediated via activation of
ETA receptors on cardiac fibroblasts. ET-1
activates the procollagen I
promoter,34 reflected in
this study by the increased collagen deposition.
TGF-ß1 protein levels were increased in the
heart of DOCA-salt rats in the first week, returning to normal
thereafter. ETA antagonism prevented the
elevation of TGF-ß1, implicating
TGF-ß1 in the fibrotic response. Not
surprisingly, no increase of TGF-ß1 was found
in the second and fourth weeks of hypertension. Indeed, a significant
rise of the TGF-ß1 55-kDa precursor has been
documented only in the initial week of pressure
overload.24 After cardiac
irradiation, TGF-ß1 mRNA rose only initially
in the first week and returned to normal
later.35 Interestingly,
there was no correlation between TGF-ß1
protein and mRNA.34
Together, these data demonstrate an ET-1–induced
TGF-ß1–dependent increase in cardiac collagen
deposition in the heart of DOCA-salt rats. Preliminary data (not shown)
demonstrate the absence of significant change in collagen-degrading
activity (matrix metalloproteinase-2) in DOCA-salt rats or under
ETA antagonism, in agreement with the previously
demonstrated absence of significant changes of cardiac matrix
metalloproteinase expression in this hypertensive
model.36
Cardiac Fibrosis in DOCA-Salt Hypertensive
Rats: Relationship With Other Endocrine Systems
The mechanism for increased ET-1 production in
DOCA-salt hypertension remains unclear. Recent studies have suggested
that vasopressin, the levels and effects of which are enhanced in
DOCA-salt
hypertension,37 38
may play a role in stimulation of ET-1 expression. A
V1 vasopressin antagonist reduced blood pressure
and vascular remodeling of DOCA-salt hypertensive
rats39 similarly to the
effects of ETA
antagonists.12 40
This was associated with abrogation of vascular overexpression of ET-1
mRNA. Genetically vasopressin-deficient Brattleboro rats do not develop
DOCA-salt hypertension and are unable to upregulate ET-1
expression.41 The mechanism
for vasopressin increase in DOCA-salt rats may be related to changes in
serum osmolality and action on the hypothalamus. This may require the
effect or presence of high salt and mineralocorticoids. Alternatively,
mineralocorticoids may potentiate the effects of vasopressin on ET-1
expression in blood vessels and heart. Mineralocorticoids, particularly
aldosterone, induce cardiac hypertrophy and fibrosis in
rats.42 Whether aldosterone
exerts its effects via ET-1, as DOCA does in the DOCA-salt rat, remains
to be determined. It is of interest to note the recently concluded
Randomized Aldactone Evaluation Study
(RALES),43 in which blockade
of aldosterone by spironolactone improved cardiac mortality in heart
failure patients, which could be mediated in part via blunting of ET-1
effects on the
heart.44
In conclusion, in DOCA-salt hypertensive rats, significantly increased interstitial and perivascular collagen deposition was observed in the left ventricular myocardium, which was prevented if rats were treated with an ETA receptor antagonist. These results suggest a role for ET-1 in increased procollagen I and III synthesis, leading to cardiac fibrosis in DOCA-salt hypertensive rats, which may have pathophysiological implications in hypertension by contributing to myocardial stiffness and contractile dysfunction.45 46 In association with this response, there is an initial increase in TGF-ß1 that may play an adjuvant role in the ETA receptor–induced cardiac fibrosis. Blockade of ETA receptors may exert beneficial cardiac effects in forms of hypertension, such as the DOCA-salt rat, in which the endothelin system is activated, and perhaps in other forms of cardiac disease, by blunting cardiac fibrosis and remodeling.
|
Acknowledgments |
|---|
This study was supported by a Group Grant from the Medical Research Council of Canada to the Multidisciplinary Research Group on Hypertension. I. Larouche received a Canadian Hypertension Society–Pfizer Canada–Medical Research Council of Canada Studentship award. The authors are grateful to André Turgeon for his excellent technical assistance.
|
Footnotes |
|---|
Guest Editor for this article was Oscar A. Carreterro, MD, Henry Ford Hospital, Detroit, Mich.
Received May 17, 2000; revision received July 26, 2000; accepted July 28, 2000.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
1. Thai HM, Van HT, Gaballa MA, et al. Effects of AT1 receptor blockade after myocardial infarct on myocardial fibrosis, stiffness, and contractility. Am J Physiol.. 1999;276:H873–H880.
2. Weber KT, Janicki JS, Pick R, et al. Myocardial fibrosis and pathologic hypertrophy in the rat with renovascular hypertension. Am J Cardiol. 1990;65:1G–7G.[Medline] [Order article via Infotrieve]
3.
Brilla CG, Pick R,
Tan LB, et al. Remodeling of the rat right and left ventricles in
experimental hypertension. Circ
Res. 1990;67:1355–1364.
4.
Weber KT, Brilla
CG. Pathological hypertrophy and cardiac interstitium: fibrosis and
renin-angiotensin-aldosterone system.
Circulation. 1991;83:1849–1865.
5.
Conrad CH, Brooks
WW, Hayes JA, et al. Myocardial fibrosis and stiffness with hypertrophy
and heart failure in the spontaneously hypertensive rat.
Circulation. 1995;91:161–170.
6.
Nicoletti A, Heudes
D, Hinglais N, et al. Left ventricular fibrosis in renovascular
hypertensive rats: effect of losartan and spironolactone.
Hypertension. 1995;26:101–111.
7. Eghbali M, Blumenfeld OO, Seifter S, et al. Localization of types I, III, IV collagen mRNAs in rat heart cells by in situ hybridization. J Mol Cell Cardiol. 1989;21:103–113.[Medline] [Order article via Infotrieve]
8.
Brilla CG, Weber
KT. Reactive and reparative myocardial fibrosis in arterial
hypertension in the rat. Cardiovasc
Res. 1992;26:671–677.
9.
Crawford DC,
Chobanian AV, Brecher P. Angiotensin II induces fibronectin expression
associated with cardiac fibrosis in the rat.
Circ Res. 1994;74:727–739.
10.
Larivière R,
Thibault G, Schiffrin EL. Increased endothelin-1 content in blood
vessels of deoxycorticosterone acetate-salt hypertensive but not in
spontaneously hypertensive rats.
Hypertension. 1993;21:294–300.
11. Day R, Larivière R, Schiffrin EL. In situ hybridization shows increased endothelin-1 mRNA levels in endothelial cells of blood vessels of deoxycorticosterone acetate-salt hypertensive rats. Am J Hypertens. 1995;8:294–300.[Medline] [Order article via Infotrieve]
12.
Li JS,
Larivière R, Schiffrin EL. Effect of a nonselective endothelin
antagonist on vascular remodeling in deoxycorticosterone acetate-salt
hypertensive rats: evidence for a role of endothelin in vascular
hypertrophy. Hypertension. 1994;24:183–188.
13.
Yamazaki T,
Konuro I, Kudoh S, et al. Endothelin-1 is involved in mechanical
stress-induced cardiomyocyte hypertrophy.
J Biol Chem. 1996;271:3221–3228.
14. Ito H, Hirata Y, Adachi S, et al. Endothelin-1 is an autocrine/paracrine factor in the mechanism of angiotensin II-induced hypertrophy in cultured rat cardiomyocytes. J Clin Invest. 1993;92:398–403.
15. Neyses L, Nouskas J, Luyken J, et al. Induction of immediate-early genes by angiotensin II and endothelin-1 in adult rat cardiomyocytes. J Hypertens. 1993;11:927–934.[Medline] [Order article via Infotrieve]
16.
Mulder P, Rochard
V, Derumeaux G, et al. Role of endogenous endothelin in chronic heart
failure: effect of long-term treatment with an endothelin antagonist on
survival, hemodynamics, and cardiac remodeling.
Circulation. 1997;96:1976–1982.
17.
Guarda E, Katwa
LC, Myers PR, et al. Effects of endothelins on collagen turnover in
cardiac fibroblasts. Cardiovasc
Res. 1993;27:2130–2134.
18. Stasch JP, Hirth-Dietrich C, Frobel K, et al. Prolonged endothelin blockade prevents hypertension and cardiac hypertrophy in stroke-prone spontaneously hypertensive rats. Am J Hypertens. 1995;8:1128–1134.[Medline] [Order article via Infotrieve]
19.
Kaddoura S, Firth
JD, Boheler KR, et al. Endothelin-1 is involved in
norepinephrine-induced ventricular hypertrophy in vivo. Acute effects
of bosentan, an orally active, mixed endothelin
ETA and ETB receptor
antagonist. Circulation. 1996;93:2068–2079.
20. Larivière R, Deng LY, Day R, et al. Increased endothelin-1 gene expression in the endothelium of coronary arteries and endocardium in the DOCA-salt hypertensive rat. J Mol Cell Cardiol. 1995;27:2123–2131.[Medline] [Order article via Infotrieve]
21.
Schiffrin EL.
Endothelin: potential role in hypertension and vascular hypertrophy.
Hypertension. 1995;25:1135–1143.
22. Li JS, Turgeon A, Schiffrin EL. Effect of chronic treatment with two different ETA-selective endothelin receptor antagonists on blood pressure and small artery structure of DOCA-salt hypertensive rats. Am J Hypertens. 1998;11:554–562.[Medline] [Order article via Infotrieve]
23. Ormsbee HS, Ryan CF. Production of hypertension with deoxycorticosterone acetate-impregnated silicone rubber implants. J Pharmacol Sci. 1973;62:255–257.[Medline] [Order article via Infotrieve]
24. Li J-M, Brooks G. Differential protein expression and subcellular distribution of TGFß1, ß2 and ß3 in cardiomyocytes during pressure overload-induced hypertrophy. J Mol Cell Cardiol. 1997;29:2213–2224.[Medline] [Order article via Infotrieve]
25. Brown L, Duce B, Miric G, et al. Reversal of cardiac fibrosis in deoxycorticosterone acetate-salt hypertensive rats by inhibition of the renin-angiotensin system. J Am Soc Nephrol. 1999;10(suppl 11):S143–S148.
26.
Chapman D, Weber
KT, Eghbali M. Regulation of fibrillar collagen types I and III and
basement membrane type IV collagen gene expression in pressure
overloaded rat myocardium. Circ
Res. 1990;67:787–794.
27. Contard F, Koteliansky V, Marotte F, et al. Specific alterations in the distribution of extracellular matrix components within rat myocardium during the development of pressure overload. Lab Invest. 1991;64:65–75.[Medline] [Order article via Infotrieve]
28. Rossi MA. Pathologic fibrosis and connective tissue matrix in left ventricular hypertrophy due to chronic arterial hypertension in humans. J Hypertens. 1998;16:1031–1041.[Medline] [Order article via Infotrieve]
29. Michel JB, Salzmann JL, Ossondo Nlom M, et al. Morphometric analysis of collagen network and plasma perfused capillary bed in the myocardium of rats during evolution of cardiac hypertrophy. Basic Res Cardiol. 1986;81:142–154.[Medline] [Order article via Infotrieve]
30. Schwartz SM, Gordon D, Mosca RS, et al. Collagen content in normal, pressure, and pressure-volume overloaded developing human hearts. Am J Cardiol. 1996;77:734–738.[Medline] [Order article via Infotrieve]
31. Larouche I, Schiffrin EL. Cardiac microvasculature in DOCA-salt hypertensive rats: effect of endothelin ETA receptor antagonism. Hypertension. 1999;34(pt 2):795–801.
32.
Lee JT, Ideker
RE, Reimer KA. Myocardial infarct size and location in relation to the
coronary vascular bed at risk in man.
Circulation. 1981;64:526–534.
33.
Hittinger L,
Shannon RP, Bishop SP, et al. Subendomyocardial exhaustion of blood
flow reserve and increased fibrosis in conscious dogs with heart
failure. Circ Res. 1989;65:971–980.
34. Chatziantoniou C, Boffa JJ, Ardaillou R, et al. Nitric oxide inhibition induces early activation of type I collagen gene in renal resistance vessels and glomeruli in transgenic mice: role of endothelin. J Clin Invest. 1998;101:2780–2789.[Medline] [Order article via Infotrieve]
35. Krüse JJCM, Bart CI, Visser A, et al. Changes in transforming growth factor-ß (TGF-ß1), procollagen types I and III mRNA in the rat heart after irradiation. Int J Radiat Biol. 1999;75:1429–1436.[Medline] [Order article via Infotrieve]
36. Robert V, Besse S, Sabri A, et al. Differential regulation of matrix metalloproteinases associated with aging and hypertension in the rat heart. Lab Invest. 1997;76:729–738.[Medline] [Order article via Infotrieve]
37.
Crofton JT, Share
L, Shade RE, et al. The importance of vasopressin in the development
and maintenance of DOCA-salt hypertension in the rat.
Hypertension. 1979;1:31–38.
38. Larivière R, St-Louis J, Schiffrin EL. Vascular binding sites and biological activity of vasopressin in DOCA-salt hypertensive rats. J Hypertens. 1988;6:211–217.[Medline] [Order article via Infotrieve]
39.
Intengan HD, He
G, Schiffrin EL. Effect of vasopressin antagonism on structure and
mechanics of small arteries and vascular expression of endothelin-1 in
deoxycorticosterone acetate salt hypertensive rats.
Hypertension. 1998;32:770–777.
40. Schiffrin EL, Turgeon A, Deng LY. Effect of chronic ETA-selective endothelin receptor antagonism on blood pressure in experimental and genetic hypertension in rats. Br J Pharmacol. 1997;121:935–940.[Medline] [Order article via Infotrieve]
41. Intengan HD, Park JB, Schiffrin EL. Blood pressure and small arteries in DOCA-salt-treated genetically AVP-deficient rats: role of endothelin. Hypertension. 1999;34(pt 2):907–913.
42. Brilla CG, Matsubara LS, Weber KT. Anti-aldosterone treatment and the prevention of myocardial fibrosis in primary and secondary hyperaldosteronism. J Mol Cell Cardiol. 1993;25:563–575.[Medline] [Order article via Infotrieve]
43.
Pitt B, Zannad F,
Remme WJ, et al, for the Randomized Aldactone Evaluation Study
Investigators. The effect of spironolactone on morbidity and mortality
in patients with severe heart failure.
N Engl J Med. 1999;341:709–717.
44.
Sutsch G, Kiowski
W, Yan XW, et al. Short-term oral endothelin-receptor antagonist
therapy in conventionally treated patients with symptomatic severe
chronic heart failure.
Circulation. 1998;98:2262–2268.
45. Bishop JE, Greenbaum R, Gibson DG, et al. Enhanced deposition of predominantly type I collagen in myocardial disease. J Mol Cell Cardiol. 1990;22:1157–1165.[Medline] [Order article via Infotrieve]
46.
Litwin SE, Litwin
CM, Raya TE, et al. Contractility and stiffness of noninfarcted
myocardium after coronary ligation in rats: effects of chronic
angiotensin converting enzyme inhibition.
Circulation. 1991;83:1028–1037.
This article has been cited by other articles:
 |
|
 |
|
  A. Jadhav and J. F. Ndisang Heme Arginate Suppresses Cardiac Lesions and Hypertrophy in Deoxycorticosterone Acetate-Salt Hypertension Experimental Biology and Medicine, July 1, 2009; 234(7): 764 - 778. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Yi, M. Xia, N. Li, C. Zhang, L. Tang, and P.-L. Li Contribution of Guanine Nucleotide Exchange Factor Vav2 to Hyperhomocysteinemic Glomerulosclerosis in Rats Hypertension, January 1, 2009; 53(1): 90 - 96. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. F. Opitz, R. Ewert, W. Kirch, and D. Pittrow Inhibition of endothelin receptors in the treatment of pulmonary arterial hypertension: does selectivity matter? Eur. Heart J., August 2, 2008; 29(16): 1936 - 1948. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T.-M. Lee, C.-C. Chen, M.-S. Lin, and N.-C. Chang Effect of endothelin receptor antagonists on ventricular susceptibility in postinfarcted rats Am J Physiol Heart Circ Physiol, April 1, 2008; 294(4): H1871 - H1879. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. C. da Costa Goncalves, R. Leite, R. A. Fraga-Silva, S. V. Pinheiro, A. B. Reis, F. M. Reis, R. M. Touyz, R. C. Webb, N. Alenina, M. Bader, et al. Evidence that the vasodilator angiotensin-(1 7)-Mas axis plays an important role in erectile function Am J Physiol Heart Circ Physiol, October 1, 2007; 293(4): H2588 - H2596. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Rivera, M. P. Ocaranza, S. Lavandero, and J. E. Jalil Rho Kinase Activation and Gene Expression Related to Vascular Remodeling in Normotensive Rats With High Angiotensin I Converting Enzyme Levels Hypertension, October 1, 2007; 50(4): 792 - 798. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. J. An, R. Boyd, M. Zhu, A. Chapman, D. R. Pimentel, and H. D. Wang NADPH oxidase mediates angiotensin II-induced endothelin-1 expression in vascular adventitial fibroblasts Cardiovasc Res, September 1, 2007; 75(4): 702 - 709. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Shimojo, S. Jesmin, S. Zaedi, S. Maeda, M. Soma, K. Aonuma, I. Yamaguchi, and T. Miyauchi Eicosapentaenoic acid prevents endothelin-1-induced cardiomyocyte hypertrophy in vitro through the suppression of TGF-beta1 and phosphorylated JNK Am J Physiol Heart Circ Physiol, August 1, 2006; 291(2): H835 - H845. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Jesmin, S. Zaedi, S. Maeda, C. N. Mowa, I. Sakuma, and T. Miyauchi Reversal of Elevated Cardiac Expression of TGF{beta}1 and Endothelin-1 in OLETF Diabetic Rats by Long-Acting Calcium Antagonist. Experimental Biology and Medicine, June 1, 2006; 231(6): 907 - 912. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Pikkarainen, H. Tokola, R. Kerkela, M. Ilves, M. Makinen, H.-D. Orzechowski, M. Paul, O. Vuolteenaho, and H. Ruskoaho Inverse regulation of preproendothelin-1 and endothelin-converting enzyme-1beta genes in cardiac cells by mechanical load Am J Physiol Regulatory Integrative Comp Physiol, June 1, 2006; 290(6): R1639 - R1645. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Jesmin, Y. Hattori, S. Maeda, S. Zaedi, I. Sakuma, and T. Miyauchi Subdepressor dose of benidipine ameliorates diabetic cardiac remodeling accompanied by normalization of upregulated endothelin system in rats Am J Physiol Heart Circ Physiol, May 1, 2006; 290(5): H2146 - H2154. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C.-H. Chen, T.-H. Cheng, H. Lin, N.-L. Shih, Y.-L. Chen, Y.-S. Chen, C.-F. Cheng, W.-S. Lian, T.-C. Meng, W.-T. Chiu, et al. Reactive Oxygen Species Generation Is Involved in Epidermal Growth Factor Receptor Transactivation through the Transient Oxidization of Src Homology 2-Containing Tyrosine Phosphatase in Endothelin-1 Signaling Pathway in Rat Cardiac Fibroblasts Mol. Pharmacol., April 1, 2006; 69(4): 1347 - 1355. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. J. An, R. Boyd, Y. Wang, X. Qiu, and H. D. Wang Endothelin-1 expression in vascular adventitial fibroblasts Am J Physiol Heart Circ Physiol, February 1, 2006; 290(2): H700 - H708. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. K. Harris, J. R. Hutchinson, K. Sachidanandam, M. H. Johnson, A. M. Dorrance, D. W. Stepp, S. C. Fagan, and A. Ergul Type 2 Diabetes Causes Remodeling of Cerebrovasculature via Differential Regulation of Matrix Metalloproteinases and Collagen Synthesis: Role of Endothelin-1 Diabetes, September 1, 2005; 54(9): 2638 - 2644. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Bouzeghrane, D. P. Reinhardt, T. L. Reudelhuber, and G. Thibault Enhanced expression of fibrillin-1, a constituent of the myocardial extracellular matrix in fibrosis Am J Physiol Heart Circ Physiol, September 1, 2005; 289(3): H982 - H991. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Emoto, S. B. Raharjo, D. Isaka, S. Masuda, S. Adiarto, A. Y. Jeng, and M. Yokoyama Dual ECE/NEP Inhibition on Cardiac and Neurohumoral Function During the Transition From Hypertrophy to Heart Failure in Rats Hypertension, June 1, 2005; 45(6): 1145 - 1152. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Amiri, A. Virdis, M. F. Neves, M. Iglarz, N. G. Seidah, R. M. Touyz, T. L. Reudelhuber, and E. L. Schiffrin Endothelium-Restricted Overexpression of Human Endothelin-1 Causes Vascular Remodeling and Endothelial Dysfunction Circulation, October 12, 2004; 110(15): 2233 - 2240. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. L. Schiffrin The Many Targets of Aldosterone Hypertension, May 1, 2004; 43(5): 938 - 940. [Full Text] [PDF]
|
|
|
|
 |
|
 T. Ogata, T. Miyauchi, S. Sakai, M. Takanashi, Y. Irukayama-Tomobe, and I. Yamaguchi Myocardial fibrosis and diastolic dysfunction in deoxycorticosterone acetate-salt hypertensive rats is ameliorated by the peroxisome proliferator-activated receptor-alpha activator fenofibrate, partly by suppressing inflammatory responses associated with the nuclear factor-kappa-b pathway J. Am. Coll. Cardiol., April 21, 2004; 43(8): 1481 - 1488. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. E. Callera, A. C. Montezano, R. M. Touyz, T. M.T. Zorn, M. H. C. Carvalho, Z. B. Fortes, D. Nigro, E. L. Schiffrin, and R. C. Tostes ETA Receptor Mediates Altered Leukocyte-Endothelial Cell Interaction and Adhesion Molecules Expression in DOCA-Salt Rats Hypertension, April 1, 2004; 43(4): 872 - 879. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Fraccarollo, P. Galuppo, S. Hildemann, M. Christ, G. Ertl, and J. Bauersachs Additive improvement of left ventricular remodeling and neurohormonal activation by aldosterone receptor blockade with eplerenone and ACE inhibition in rats with myocardial infarction J. Am. Coll. Cardiol., November 5, 2003; 42(9): 1666 - 1673. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Ergul, V. Portik-Dobos, A. D. Giulumian, M. M. Molero, and L. C. Fuchs Stress upregulates arterial matrix metalloproteinase expression and activity via endothelin A receptor activation Am J Physiol Heart Circ Physiol, November 1, 2003; 285(5): H2225 - H2232. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Iglarz, R. M. Touyz, E. C. Viel, P. Paradis, F. Amiri, Q. N. Diep, and E. L. Schiffrin Peroxisome Proliferator-Activated Receptor-{alpha} and Receptor-{gamma} Activators Prevent Cardiac Fibrosis in Mineralocorticoid-Dependent Hypertension Hypertension, October 1, 2003; 42(4): 737 - 743. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Javeshghani, R. M. Touyz, M. R. Sairam, A. Virdis, M. F. Neves, and E. L. Schiffrin Attenuated Responses to Angiotensin II in Follitropin Receptor Knockout Mice, a Model of Menopause-Associated Hypertension Hypertension, October 1, 2003; 42(4): 761 - 767. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. C. White Aldosterone: Direct Effects on and Production by the Heart J. Clin. Endocrinol. Metab., June 1, 2003; 88(6): 2376 - 2383. [Full Text] [PDF]
|
|
|
|
|
|
C.-M. Cheng, H.-J. Hong, J.-C. Liu, N.-L. Shih, S.-H. Juan, S.-H. Loh, P. Chan, J.-J. Chen, and T.-H. Cheng Crucial Role of Extracellular Signal-Regulated Kinase Pathway in Reactive Oxygen Species-Mediated Endothelin-1 Gene Expression Induced by Endothelin-1 in Rat Cardiac Fibroblasts Mol. Pharmacol., May 1, 2003; 63(5): 1002 - 1011. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. M. Seccia, A. S. Belloni, R. Kreutz, M. Paul, G. G. Nussdorfer, A. C. Pessina, and G. P. Rossi Cardiac fibrosis occurs early and involves endothelin and AT-1 receptors in hypertension due to endogenous angiotensin II J. Am. Coll. Cardiol., February 19, 2003; 41(4): 666 - 673. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. P. Rossi, C. Ganzaroli, M. Cesari, A. Maresca, M. Plebani, G. G. Nussdorfer, and A. C. Pessina Endothelin receptor blockade lowers plasma aldosterone levels via different mechanisms in primary aldosteronism and high-to-normal renin hypertension Cardiovasc Res, January 1, 2003; 57(1): 277 - 283. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. G. Kay, P. Yue, Z. Hanna, S. Jothy, E. Tremblay, and P. Jolicoeur Cardiac Disease in Transgenic Mice Expressing Human Immunodeficiency Virus-1 Nef in Cells of the Immune System Am. J. Pathol., July 1, 2002; 161(1): 321 - 335. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Fraccarollo, P. Galuppo, J. Bauersachs, and G. Ertl Collagen accumulation after myocardial infarction: effects of ETA receptor blockade and implications for early remodeling: Presented in part at the 72nd Scientific Session of the American Heart Association, Atlanta, GA, USA, November 7-10, 1999, and published in abstract form (Circulation 1999;100(Suppl. 1):562) Cardiovasc Res, June 1, 2002; 54(3): 559 - 567. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Fraccarollo, J. Bauersachs, M. Kellner, P. Galuppo, and G. Ertl Cardioprotection by long-term ETA receptor blockade and ACE inhibition in rats with congestive heart failure: mono- versus combination therapy Cardiovasc Res, April 1, 2002; 54(1): 85 - 94. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Tsuruda, M. Jougasaki, G. Boerrigter, B. K. Huntley, H. H. Chen, A. B. D'Assoro, S. C. Lee, A. M. Larsen, A. Cataliotti, and J. C. Burnett Jr Cardiotrophin-1 Stimulation of Cardiac Fibroblast Growth: Roles for Glycoprotein 130/Leukemia Inhibitory Factor Receptor and the Endothelin Type A Receptor Circ. Res., February 8, 2002; 90(2): 128 - 134. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Z. Ammarguellat, P. O. Gannon, F. Amiri, and E. L. Schiffrin Fibrosis, Matrix Metalloproteinases, and Inflammation in the Heart of DOCA-Salt Hypertensive Rats: Role of ETA Receptors Hypertension, February 1, 2002; 39(2): 679 - 684. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. P. van Kats, D. Methot, P. Paradis, D. W. Silversides, and T. L. Reudelhuber Use of a Biological Peptide Pump to Study Chronic Peptide Hormone Action in Transgenic Mice. DIRECT AND INDIRECT EFFECTS OF ANGIOTENSIN II ON THE HEART J. Biol. Chem., November 16, 2001; 276(47): 44012 - 44017. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. D. Intengan and E. L. Schiffrin Vascular Remodeling in Hypertension: Roles of Apoptosis, Inflammation, and Fibrosis Hypertension, September 1, 2001; 38(3): 581 - 587. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. B. Park and E. L. Schiffrin ETA Receptor Antagonist Prevents Blood Pressure Elevation and Vascular Remodeling in Aldosterone-Infused Rats Hypertension, June 1, 2001; 37(6): 1444 - 1449. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Tsuruda, M. Jougasaki, G. Boerrigter, B. K. Huntley, H. H. Chen, A. B. D'Assoro, S. C. Lee, A. M. Larsen, A. Cataliotti, and J. C. Burnett Jr Cardiotrophin-1 Stimulation of Cardiac Fibroblast Growth: Roles for Glycoprotein 130/Leukemia Inhibitory Factor Receptor and the Endothelin Type A Receptor Circ. Res., February 8, 2002; 90(2): 128 - 134. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||