(Circulation. 2001;103:196.)
© 2001 American Heart Association, Inc.
Clinical Investigation and Reports |
From the Molecular Cardiology Laboratories, IRCCS Fondazione Salvatore Maugeri, Pavia, Italy (S.G.P., C.N., M.M., R.B.); Department of Cardiology, University of Pavia, Pavia, Italy (S.G.P.); Laboratory of Human Genetics, Department of Biology, University of Padova, Padova, Italy (N.T., G.A.D.); Cardiology Department A De Gasperis, Niguarda Hospital, Milan, Italy (G.V.); DIBIT, Scientific Institute San Raffaele, Milan, Italy (V.S.); and the Molecular Medicine Section, Department of Neuroscience, University of Siena, Italy (V.S).
Correspondence to Silvia G. Priori, MD, PhD, Director of Molecular Cardiology, Fondazione Salvatore Maugeri, Associate Professor of Cardiology, University of Pavia, Via Ferrata 8, 27100 Pavia, Italy. E-mail spriori{at}fsm.it
| Abstract |
|---|
|
|
|---|
Methods and ResultsTwelve patients presenting with typical catecholaminergic polymorphic ventricular tachycardia in the absence of structural heart abnormalities were identified. DNA was extracted from peripheral blood lymphocytes, and single-strand conformation polymorphism analysis was performed on polymerase chain reactionamplified exons of the hRyR2 gene. Four single nucleotide substitutions leading to missense mutations were identified in 4 probands affected by the disease. Genetic analysis of the asymptomatic parents revealed that 3 probands carried de novo mutations. In 1 case, the identical twin of the proband died suddenly after having suffered syncopal episodes. The fourth mutation was identified in the proband, in 4 clinically affected family members, and in none of 3 nonaffected family members in a kindred with 2 sudden deaths that occurred at 16 and 14 years, respectively, in the sisters of the proband.
ConclusionsWe demonstrated that, in agreement with our hypothesis, hRyR2 is a gene responsible for catecholaminergic polymorphic ventricular tachycardia.
Key Words: arrhythmia genetics tachycardia ryanodine receptor calcium release channel
| Introduction |
|---|
|
|
|---|
On the basis of both the typical electrocardiographic pattern and on the hypothesis that delayed afterdepolarizations underlie arrhythmias in this disease, we hypothesized that mutations of the human cardiac ryanodine receptor gene (hRyR2)4 mapped to 1q42-q435 6 may be associated with catecholaminergic polymorphic VT. We detected 4 missense mutations cosegregating with the clinical phenotype. These data suggest that hRyR2 is a gene for catecholaminergic VT.
| Methods |
|---|
|
|
|---|
All patients gave informed consent to the clinical and genetic study; the study was approved by the internal ethics committee of Fondazione Salvatore Maugeri.
Mutation Screening
Mutation screening was performed on genomic DNA
samples that were extracted from peripheral blood lymphocytes using
standard methods,7 and the
genomic structure of the hRyR2
gene was obtained (by N.T. and
G.A.D.).8 Intronic primers
that amplify 90 of 103 exons, including those corresponding to the
protein domain involved in interactions with
FKBP12.6,9
were used for polymerase chain reaction
amplifications.4 Polymerase
chain reaction products ranging from 120 to 300 bp were analyzed by
single-strand conformation polymorphisms (SSCP) on nondenaturing
polyacrylamide gels. All abnormal conformers were sequenced using a
ABI310 genetic analyzer. A control group of 400 healthy and unrelated
subjects (800 alleles) was used to exclude the possibility of the
detected mutations being DNA polymorphisms. Additionally, for all
patients included in the present study, the entire coding sequences of
the KCNQ1, KCNH2, SCN5A,
KCNE1, and KCNE2 genes were screened using
previously described primer pairs10 to exclude the
possibility of atypical variants of long-QT
syndrome.11
| Results |
|---|
|
|
|---|
|
Family B
The proband of family B is an 8-year-old boy
(II-1 in
Figure 1
) who was referred (to G.V.) because of the
occurrence of repeated syncopal episodes. The identical twin of the
index case had a history of repeated syncopal events and died suddenly
at 7 years of age; autopsy failed to demonstrate abnormal findings, and
death was attributed to cardiac arrest. The parents of the twins are
asymptomatic, with normal hearts and no exercise-induced arrhythmias.
The baseline ECG of the proband is unremarkable, with normal PR and QT
intervals and no abnormalities of ventricular repolarization.
Nonsustained, bidirectional VT was reproducibly induced during exercise
stress testing. No structural and functional abnormalities were
detected with MRI or during right and left ventriculography. The
patient was treated with atenolol (2
mg · kg1 · d1),
and adequate control of the arrhythmias was achieved with no
recurrences of syncope after 6 years of
follow-up.
Family C
The proband of family C is a 14-year-old boy (II-1 in
Figure 1
) who was referred (to G.V.) because of frequent
episodes of loss of consciousness during exercise, which began at 7
years of age. No family history of sudden cardiac death and/or syncopal
episodes was present. The parents are asymptomatic, with normal hearts
and no exercise-induced arrhythmias. Baseline ECG of the proband was
normal, and nonsustained, bidirectional VT was reproducibly elicited by
exercise stress testing. No cardiac abnormalities were identified with
echocardiography, MRI, or right and left ventriculography. The patient
was treated with atenolol (2
mg · kg1 · d1),
which prevented recurrences of syncope and the onset of repetitive
exercise-induced ventricular arrhythmias during 9 years of
follow-up.
Family D
The proband of family D (III-3 in
Figure 2
) underwent cardiac evaluation at 30 years when she
experienced palpitations. Her family history included the sudden
cardiac death of 2 sisters, which occurred when they were 14 and 16
years old, respectively. One of the 2 girls died while being tested at
school and the second while climbing stairs. The Holter
recording demonstrated nonsustained, bidirectional, polymorphic VT
(maximum of 15 beats). Because of the family history of cardiac arrest,
an ICD was implanted. The family was then referred (to S.G.P.) for
clinical and genetic evaluation.
|
Clinical evaluation of family members across 4 generations
demonstrated that the proband (III-3 in
Figure 2
), her mother (II-1 in
Figure 2
; age, 59 years), 2 of her sisters (III-2 and III-4
in
Figure 2
; ages, 28 and 36 years), and her brother (III-1 in
Figure 2
; age, 23 years) developed bidirectional VT during
exercise stress testing. None of them had structural abnormalities of
the heart. Six additional family members (II-2, II-3, III-5, III-6,
IV-1, and IV-2 in
Figure 2
) underwent clinical evaluation, and none developed
ventricular arrhythmias during exercise stress testing. The 92-year-old
grandfather of the proband (I-1 in
Figure 2
) did not carry the genetic defect. He was
asymptomatic for syncopal events and had no arrhythmias at Holter
recording, but he could not perform exercise stress testing because of
severe arthritis.
During 1 year of follow-up after ICD implantation, the proband experienced 2 appropriate shocks that successfully terminated ventricular fibrillation. On both occasions, emotional stress preceded the events: the first episode occurred while the patient was being fired by her boss; the second while she was acting in a play at the local school.
Identification of
hRyR2 Mutations
Four different single nucleotide substitutions leading
to hRyR2 missense mutations
(nonconservative amino acid changes) were identified in the 4 probands
with catecholaminergic VT. A Ser to Leu substitution at position 2246
(exon 44) was identified in the proband of family A
(Figure 1
), an Arg to Ser substitution at position 2474 (exon
49) in the proband of family B
(Figure 1
), an Asn to Lys substitution at position 4104 (exon
90) in the proband of family C
(Figure 1
), and a Arg to Cys substitution at position 4497
(exon 93) in the proband of family D
(Figure 2
).
The primer pairs used to amplify the mutated exons were as follows: Exon 44: 44F, GTTACAGCACGATCCAGGTT; 44R, GAGAAAACCGTGAAAAAGCA Exon 49: 49F, ACAGCCATTGACACCAAAAT; 49R, AGAGAGGAGGAAGTCCATCG Exon 90: 90bF, GAGCCATAAGCACTACACGC; 90bR, ATAGACCCTCTCGATGCGTT Exon 94: 93F, AGGTTTCAAGCCTGTTGATTC; 93R, GCCTAGGCACCAGTATTTCA
In 3 cases, the mutations were de novo and they were not inherited from the parents (biological paternity was confirmed by DNA analysis). The last hRyR2 mutation was present in all 5 individuals with the clinical phenotype (II-1, III-1, III-2, III-3, and III-4) and in none of the 6 with a negative clinical phenotype (100% concordance between clinical and genetic diagnosis; 100% penetrance). None of the mutations was present in the DNA obtained from 400 normal subjects (800 alleles).
| Discussion |
|---|
|
|
|---|
Background
In 1995, Leenhardt et
al2 described a series of
patients with a remarkably uniform pattern of stress-induced,
bidirectional, polymorphic VT in the absence of structural heart
disease. Approximately one third of the cases had a family history of
juvenile sudden death and/or stress-related syncope. Of interest, most
of the patients were the only affected individual in their family, thus
suggesting either the existence of incomplete penetrance of the genetic
defect or the occurrence of de novo mutations. The presence of
bidirectional VT and the reproducible pattern of adrenergic-induced
ventricular ectopic activity are very important distinguishing features
of this disease and its pathogenesis. In contrast with patients who
have long-QT syndrome, the patients described by Coumel et
al1 and Leenhardt et
al2 have a normal QT
interval, they do not develop VT with a pattern of torsade des pointes,
and their VT is easily inducible during exercise stress testing. In
their study, Leenhardt et al2
stated that the bidirectional arrhythmias observed in their patients
had an "ECG pattern most commonly described in digitalis
toxicity."16 This
observation points to delayed afterdepolarizations as a likely
arrhythmogenic mechanism in these
patients.13 Delayed
afterdepolarizations are caused by intracellular calcium overload, as
occurs with digitalis
toxicity,17 and abnormal
calcium release from the sarcoplasmic reticulum; they are enhanced by
adrenergic
stimulation13 14
and are blocked by the in vitro administration of
ryanodine.13 Thus, the human
cardiac ryanodine receptor gene seemed to be a good candidate for this
form of idiopathic ventricular arrhythmia.
Mutations in the
hRyR2 Gene in Patients With
Catecholaminergic VT
We identified mutations in the
hRyR2 gene in 4 of 12 probands.
Two of the 4 genotyped probands had a family history of juvenile sudden
cardiac death. In one case (family B), the identical twin of the
proband, who had history of stress-related syncopal events since he was
3 years old, died suddenly (negative autopsy) at 7 years of age while
running on the beach. In the second case (family D), 2 sisters of the
proband (both with negative autopsy) died suddenly at 14 years (while
being tested at school) and 16 years (while climbing stairs). A
clinical evaluation of the family members of the proband in family D
demonstrated that the 5 gene carriers presented with bidirectional VT
when performing even a moderate degree of exercise. The pattern of
arrhythmias was identical in the proband and the other 4 carriers
(Figure 3
). The mutation identified in this 4-generation
family clearly cosegregates with the clinical phenotype. In this
family, cardiac arrest occurred during adolescence in the 2 sisters who
died suddenly but several years later (30 years) in the
proband, suggesting a variable age-related manifestation of the
disease.
|
On the basis of the published amino acid sequence of hRyR2,4 all 4 mutations involve highly conserved residues among the hRyR homologues and RyR proteins from other animal species, thus reinforcing the hypothesis that these mutations are associated with functional changes in the hRyR2 gene product. Some interesting observations stem from the comparison of the mutations identified here and those found in the RYR1 gene (skeletal muscle homologue of RyR2) that are associated with 2 human diseases affecting skeletal muscle, MH and CCD. MH is a pharmacogenetic disorder of skeletal muscle triggered by common anesthetics and depolarizing muscle relaxants and, in some susceptible individuals, by severe exercise. CCD is a nonprogressive myopathy characterized by hypotonia and proximal muscle weakness. CCD is usually closely associated with MH.15
Mutations in MH and CCD patients are clustered in 3 regions of the RYR1 gene: region 1 corresponds to the first 614 amino acids (aa); region 2 corresponds to a region between aa and 2162 to 2458; and region 3 corresponds to the C-terminal region of the RYR1-encoded protein, where mutations have been found in the pore-forming region of the encoded channel between aa and 4800 to 4900.15 An alignment of the mutations Ser 2246 Leu and Arg 2474 Ser, which was found in families A and B, with the corresponding aa sequence in the RYR1 protein locates these 2 mutations: one is in the center of the second cluster of MH/CCD mutations and the second is very close to the same region. However, Asn 4104 Lys is very close to and Arg 4497 Cys lies within the "D1" region (divergent region 1),18 19 20 which is one of the most investigated region of the RYR1 protein because it appears to contain important sites for regulating channel functions.15 18 19 20 21
Marx et al22 recently reported that adrenergic stimulation of cardiomyocytes results in the hyperphosphorylation of RyR2 through PKA, which results in FKBP12.6 displacement and altered channel activity and, thus, cardiac dysfunction. Mutations found in MH/CCD patients increase the sensitivity of the mutant RYR1 channels to activating concentrations of Ca2+.15 18 19 In analogy, it is reasonable to envision that patients with catecholaminergic VT, as a consequence of the observed mutations in the hRyR2 gene, have an increased sensitivity to Ca2+; therefore, intense adrenergic stimulation due to emotional stress and/or increased physical activity may lead to calcium overload and precipitate severe tachyarrhythmias.
We identified hRyR2 mutations in 4 of 12 patients with catecholaminergic VT. This may be due to the fact that we have not yet completed the screening of this very large gene or to incomplete sensitivity of the screening techniques. We favor the hypothesis that, in analogy with other arrhythmogenic disorders, genetic heterogeneity underlies catecholaminergic VT. The finding of hRyR2 mutations in ARVD2,8 mapped to 1q42-q43,23 raises the question of the possible allelism of ARVD2 and catecholaminergic VT.
In summary, we present evidence suggesting that mutations in RyR2 are likely to cause catecholaminergic VT. This finding suggests cardiac intracellular calcium release channels may have a role in the genesis of human arrhythmogenic disorders.
| Acknowledgments |
|---|
| Footnotes |
|---|
Received November 10, 2000; revision received November 29, 2000; accepted November 29, 2000.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
D. A. Arvanitis, D. Sanoudou, F. Kolokathis, E. Vafiadaki, V. Papalouka, A. Kontrogianni-Konstantopoulos, G. N. Theodorakis, I. A. Paraskevaidis, S. Adamopoulos, G. W. Dorn II, et al. The Ser96Ala variant in histidine-rich calcium-binding protein is associated with life-threatening ventricular arrhythmias in idiopathic dilated cardiomyopathy Eur. Heart J., July 9, 2008; (2008) ehn328v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. R. Behr, C. Dalageorgou, M. Christiansen, P. Syrris, S. Hughes, M. T. Tome Esteban, E. Rowland, S. Jeffery, and W. J. McKenna Sudden arrhythmic death syndrome: familial evaluation identifies inheritable heart disease in the majority of families Eur. Heart J., July 1, 2008; 29(13): 1670 - 1680. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Kurebayashi, H. Nishizawa, Y. Nakazato, H. Kurihara, S. Matsushita, H. Daida, and Y. Ogawa Aberrant cell-to-cell coupling in Ca2+-overloaded guinea pig ventricular muscles Am J Physiol Cell Physiol, June 1, 2008; 294(6): C1419 - C1429. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A.M. Wilde, Z. A. Bhuiyan, L. Crotti, M. Facchini, G. M. De Ferrari, T. Paul, C. Ferrandi, D. R. Koolbergen, A. Odero, and P. J. Schwartz Left Cardiac Sympathetic Denervation for Catecholaminergic Polymorphic Ventricular Tachycardia N. Engl. J. Med., May 8, 2008; 358(19): 2024 - 2029. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. M. Beckmann, A. A.M. Wilde, and S. Kaab Dual Inheritance of Sudden Death from Cardiovascular Causes N. Engl. J. Med., May 8, 2008; 358(19): 2077 - 2078. [Full Text] [PDF] |
||||
![]() |
Heart Rhythm UK Familial Sudden Death Syndromes St Clinical indications for genetic testing in familial sudden cardiac death syndromes: an HRUK position statement Heart, April 1, 2008; 94(4): 502 - 507. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Yamamoto, M. Yano, X. Xu, H. Uchinoumi, H. Tateishi, M. Mochizuki, T. Oda, S. Kobayashi, N. Ikemoto, and M. Matsuzaki Identification of Target Domains of the Cardiac Ryanodine Receptor to Correct Channel Disorder in Failing Hearts Circulation, February 12, 2008; 117(6): 762 - 772. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Liu and S. G. Priori Disruption of calcium homeostasis and arrhythmogenesis induced by mutations in the cardiac ryanodine receptor and calsequestrin Cardiovasc Res, January 15, 2008; 77(2): 293 - 301. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A. Venetucci, A. W. Trafford, S. C. O'Neill, and D. A. Eisner The sarcoplasmic reticulum and arrhythmogenic calcium release Cardiovasc Res, January 15, 2008; 77(2): 285 - 292. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Gyorke and D. Terentyev Modulation of ryanodine receptor by luminal calcium and accessory proteins in health and cardiac disease Cardiovasc Res, January 15, 2008; 77(2): 245 - 255. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Belevych, Z. Kubalova, D. Terentyev, R. L. Hamlin, C. A. Carnes, and S. Gyorke Enhanced Ryanodine Receptor-Mediated Calcium Leak Determines Reduced Sarcoplasmic Reticulum Calcium Content in Chronic Canine Heart Failure Biophys. J., December 1, 2007; 93(11): 4083 - 4092. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Jiang, W. Chen, R. Wang, L. Zhang, and S. R. W. Chen Loss of luminal Ca2+ activation in the cardiac ryanodine receptor is associated with ventricular fibrillation and sudden death PNAS, November 13, 2007; 104(46): 18309 - 18314. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E. Lehnart, M. J. Ackerman, D. W. Benson Jr, R. Brugada, C. E. Clancy, J. K. Donahue, A. L. George Jr, A. O. Grant, S. C. Groft, C. T. January, et al. Inherited Arrhythmias: A National Heart, Lung, and Blood Institute and Office of Rare Diseases Workshop Consensus Report About the Diagnosis, Phenotyping, Molecular Mechanisms, and Therapeutic Approaches for Primary Cardiomyopathies of Gene Mutations Affecting Ion Channel Function Circulation, November 13, 2007; 116(20): 2325 - 2345. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Cerrone, S. F. Noujaim, E. G. Tolkacheva, A. Talkachou, R. O'Connell, O. Berenfeld, J. Anumonwo, S. V. Pandit, K. Vikstrom, C. Napolitano, et al. Arrhythmogenic Mechanisms in a Mouse Model of Catecholaminergic Polymorphic Ventricular Tachycardia Circ. Res., November 9, 2007; 101(10): 1039 - 1048. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. A. Bhuiyan, M. P. van den Berg, J. P. van Tintelen, M. T.E. Bink-Boelkens, A. C.P. Wiesfeld, M. Alders, A. V. Postma, I. van Langen, M. M.A.M. Mannens, and A. A.M. Wilde Expanding Spectrum of Human RYR2-Related Disease: New Electrocardiographic, Structural, and Genetic Features Circulation, October 2, 2007; 116(14): 1569 - 1576. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Mohler and X. H. T. Wehrens Mechanisms of Human Arrhythmia Syndromes: Abnormal Cardiac Macromolecular Interactions Physiology, October 1, 2007; 22(5): 342 - 350. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Antzelevitch Role of spatial dispersion of repolarization in inherited and acquired sudden cardiac death syndromes Am J Physiol Heart Circ Physiol, October 1, 2007; 293(4): H2024 - H2038. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Meng, B. Xiao, S. Cai, X. Huang, F. Li, J. Bolstad, R. Trujillo, J. Airey, S. R. W. Chen, T. Wagenknecht, et al. Three-Dimensional Localization of Serine 2808, a Phosphorylation Site in Cardiac Ryanodine Receptor J. Biol. Chem., August 31, 2007; 282(35): 25929 - 25939. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Stephenson and C. I. Berul Electrophysiological Interventions for Inherited Arrhythmia Syndromes Circulation, August 28, 2007; 116(9): 1062 - 1080. [Full Text] [PDF] |
||||
![]() |
N. H. Robin, P. B. Tabereaux, R. Benza, and B. R. Korf Genetic Testing in Cardiovascular Disease J. Am. Coll. Cardiol., August 21, 2007; 50(8): 727 - 737. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Morita, D. P. Zipes, S. T. Morita, and J. Wu Mechanism of U wave and polymorphic ventricular tachycardia in a canine tissue model of Andersen-Tawil syndrome Cardiovasc Res, August 1, 2007; 75(3): 510 - 518. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. P. Dirksen, V. A. Lacombe, M. Chi, A. Kalyanasundaram, S. Viatchenko-Karpinski, D. Terentyev, Z. Zhou, S. Vedamoorthyrao, N. Li, N. Chiamvimonvat, et al. A mutation in calsequestrin, CASQ2D307H, impairs Sarcoplasmic Reticulum Ca2+ handling and causes complex ventricular arrhythmias in mice Cardiovasc Res, July 1, 2007; 75(1): 69 - 78. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Paavola, M. Viitasalo, P. J. Laitinen-Forsblom, M. Pasternack, H. Swan, I. Tikkanen, L. Toivonen, K. Kontula, and M. Laine Mutant ryanodine receptors in catecholaminergic polymorphic ventricular tachycardia generate delayed afterdepolarizations due to increased propensity to Ca2+ waves Eur. Heart J., May 1, 2007; 28(9): 1135 - 1142. [Abstract] [Full Text] [PDF] |
||||
![]() |
E R Behr, A Casey, M Sheppard, M Wright, T J Bowker, M J Davies, W J McKenna, and D A Wood Sudden arrhythmic death syndrome: a national survey of sudden unexplained cardiac death Heart, May 1, 2007; 93(5): 601 - 605. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. P. Katra, T. Oya, G. S. Hoeker, and K. R. Laurita Ryanodine receptor dysfunction and triggered activity in the heart Am J Physiol Heart Circ Physiol, May 1, 2007; 292(5): H2144 - H2151. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. Werdich, F. Baudenbacher, I. Dzhura, L. H. Jeyakumar, P. J. Kannankeril, S. Fleischer, A. LeGrone, D. Milatovic, M. Aschner, A. W. Strauss, et al. Polymorphic ventricular tachycardia and abnormal Ca2+ handling in very-long-chain acyl-CoA dehydrogenase null mice Am J Physiol Heart Circ Physiol, May 1, 2007; 292(5): H2202 - H2211. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. E. D. J. ter Keurs and P. A. Boyden Calcium and Arrhythmogenesis Physiol Rev, April 1, 2007; 87(2): 457 - 506. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Iyer, R. J. Hajjar, and A. A. Armoundas Mechanisms of Abnormal Calcium Homeostasis in Mutations Responsible for Catecholaminergic Polymorphic Ventricular Tachycardia Circ. Res., February 2, 2007; 100(2): e22 - e31. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A. Venetucci, A. W. Trafford, and D. A. Eisner Increasing Ryanodine Receptor Open Probability Alone Does Not Produce Arrhythmogenic Calcium Waves: Threshold Sarcoplasmic Reticulum Calcium Content Is Required Circ. Res., January 5, 2007; 100(1): 105 - 111. [Abstract] [Full Text] [PDF] |
||||
![]() |
|