(Circulation. 2001;103:2387.)
© 2001 American Heart Association, Inc.
Basic Science Reports |
Novel Molecular Mechanism of Increased Myocardial Endothelin-1 Expression in the Failing Heart Involving the Transcriptional Factor Hypoxia-Inducible Factor-1
Induced for Impaired Myocardial Energy Metabolism
From the Cardiovascular Division (Y.K., T.M., K.Y., N.M., I.Y.), Department of Internal Medicine, Institute of Clinical Medicine, and Department of Pharmacology (K.G.), Institute of Basic Medical Sciences, University of Tsukuba, Ibaraki, Japan.
Correspondence to Takashi Miyauchi, MD, PhD, Cardiovascular Division, Department of Internal Medicine, Institute of Clinical Medicine, University of Tsukuba, Tsukuba, Ibaraki 305-8575, Japan. E-mail t-miyauc{at}md.tsukuba.ac.jp
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
Background—Hypoxia-inducible factor (HIF)-1
is an important transcriptional factor that
activates the gene expression of glycolytic enzymes, which are
activated as compensation for impaired ß-oxidation of fatty
acid in the failing heart. We reported that cardiac endothelin (ET)-1
expression is markedly increased in heart failure. The mechanism,
however, is unknown. Because we found an HIF-1 binding site in the
5'-promoter region of the ET-1 gene, we hypothesized that HIF-1 is
involved in this mechanism.
Methods and Results—In
rat cardiomyocytes, luciferase assay and electrophoretic
mobility shift assay showed that HIF-1 transcriptionally
activates ET-1 gene expression by direct interaction with the
predicted DNA binding site in the 5'-promoter region. HIF-1 mRNA and
ET-1 mRNA in the failing heart increased during the aggravation of
heart failure in vivo in animal models, ie, rats with myocardial
infarction and hamsters with cardiomyopathy. In
cultured cardiomyocytes treated with a mitochondrial
inhibitor, HIF-1 mRNA and ET-1 mRNA were markedly
increased with activated glycolysis, and antisense
oligonucleotide for HIF-1 largely inhibited the
increased gene expression of ET-1.
Conclusions—The
present study revealed a novel molecular mechanism of upregulation
of myocardial ET-1 in heart failure, indicating that induction of
HIF-1 to stimulate glycolysis as an adaptation in heart failure
against impaired energy metabolism alternatively causes an
elevation of cardiac ET-1 gene expression as a
maladaptation.
Key Words: endothelin • heart failure • metabolism • genes
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Vascular endothelial cells and cardiomyocytes produce endothelin (ET)-1 with various pathophysiological roles.1 2 3 We previously reported that production of ET-1 in the heart was increased in rats with heart failure4 5 and that an ETA receptor antagonist improved the survival rate and hemodynamic parameters.5 Various ET receptor antagonists were reported to be effective in animals with heart failure.1 5 6 7 The mechanism by which ET-1 gene expression is increased in the failing heart, however, is unknown. The purpose of the present study was to answer this question.
From the point of view of energy metabolism, a
switch in a principal ATP source from mitochondrial fatty acid
oxidation (ß-oxidation system) to a glycolytic system may be involved
in the pathophysiology of heart failure, because it has been reported
that in heart failure, key enzymes in ß-oxidation are downregulated,
with impaired incorporation of fatty acid as a substrate for
ß-oxidation.8 9
In the mechanism of the activation of glycolysis,
hypoxia-inducible factor (HIF)-1, a transcription factor, is
known to be involved in the increased expression of glycolytic
enzymes.10 11
HIF-1 is involved in the responses of cells subjected to hypoxic
stress.10 12 It
is also known that HIF-1 transcriptionally regulates
erythropoietin13 and
vascular endothelial growth
factor14 by recognizing a
DNA element in regulatory regions and forming heterodimerization with
arylhydrocarbon-receptor nuclear translocator
(ARNT).11 Therefore, in the
progression of heart failure, in which impaired energy
metabolism may occur, HIF-1 is likely to be involved in
the activation of the glycolytic system. Because we found that a
HIF-1 recognition site exists in the 5'-promoter region of the ET-1
gene, we hypothesized that HIF-1 is involved in increased myocardial
expression of the ET-1 gene in heart
failure.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
In the present study, we performed 4 series of experiments. Series 1 was to investigate the level of both HIF-1
mRNA and ET-1 mRNA in the failing heart of 2 animal models with heart
failure. Series 2 was performed to examine whether direct mitochondrial
inhibition causes increases in HIF-1 mRNA and ET-1 mRNA in cultured
cardiomyocytes. Series 3 was performed to investigate
whether HIF-1 transcriptionally activates ET-1 mRNA
expression through binding to the promoter region of the ET-1 gene.
Series 4 was to investigate whether direct inhibition of HIF-1 by
antisense oligonucleotide affects ET-1 gene expression
to reveal that HIF-1 plays a crucial role for ET-1 gene
expression.
Experimental Series 1: In Vivo Models of Heart
Failure: Rats With Myocardial Infarction and Hamsters With
Cardiomyopathy
1. Rats with heart failure due to myocardial
infarction: As a model of heart failure, we used Sprague-Dawley rats
with myocardial infarction caused by left coronary artery
ligation.4 5
2. Cardiomyopathic hamsters (CHF146 hamsters) with heart failure: CHF146 cardiomyopathic hamsters were used in the present study.15 CHF148 hamsters, which do not develop heart failure, were used as controls.
3. Hemodynamic measurement and tissue sampling in rats and hamsters: Hemodynamic measurements were performed according to our previous reports.4 5 6
Measurement of the Level of mRNA for ET-1 and
HIF-1 in the Failing Heart
1. Analysis of gene expression by
RT-PCR: RNA isolation and RT-PCR were performed as in our previous
reports.6 16 The
upstream and downstream gene-specific primers were as follows:
HIF-1 sense: 5'-AGTCAGCAACGTGGAAGG-3'; HIF-1 antisense:
5'-GGGAGAAAAGCAAGTCGTG-3'; ET-1 sense: 5'-TCT- TCTCTCTGCTGTTTGTG-3';
ET-1 antisense: 5'-TTAGTTTTCT- TCCCTCCACC-3'; ß-actin sense:
5'-GAAGATCCTGACCGAGC- GTG-3'; and ß-actin antisense:
5'-CGTACTCCTGCTTGCTGATCC-3'.
Polymerase chain reaction (PCR) was performed with the
annealing temperature and required cycles for each template as follows:
56°C and 28 cycles for HIF-1, 52°C and 26 cycles for ET-1, and
72°C and 24 cycles for ß-actin.
Experimental Series 2: Measurement of mRNA for
ET-1 and HIF-1 in Cardiomyocytes Treated With a Mitochondrial
Inhibitor
1. Isolation and primary culture of rat
cardiomyocytes: As demonstrated in our previous
report,16
cardiomyocytes were isolated from the hearts of 2-day-old
Sprague-Dawley rat neonates and cultured.
2. In vitro study investigating the effects of cobalt
chloride (CoCl2), a mitochondrial
inhibitor, on gene expression in
cardiomyocytes: In the present study,
CoCl2 or rotenone (1 µmol/L), a mitochondrial
inhibitor,17 18
was used to impair mitochondrial function. Cardiomyocytes were treated
with 100 µmol/L CoCl2 for 6
hours.10 19
Reverse transcription (RT)-PCR was performed for the evaluation of gene
expression of atrial natriuretic peptide (ANP), ET-1, and
HIF-1. The upstream and downstream gene-specific primers of ANP were
as follows: ANP sense: 5'-ATGGGGCTCCTTCTCCATCACC-3'; and ANP antisense:
5'-TCCGCTCTGGGCTCCAATCCTGT-3'. The annealing temperature and required
cycles of PCR for ANP were 65°C and 26 cycles.
3. Measurement of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) reduction activity in cultured cardiomyocytes: The mitochondrial function of cardiomyocytes was evaluated by MTT assay as previously described.20
4. Measurement of intracellular ATP in cardiomyocytes: Intracellular ATP contents were evaluated with an ATP assay system kit (a firefly luciferase–based method) (Toyo Beanet).
5. Measurement of glucose consumption of cardiomyocytes: The concentration of glucose in the culture medium was measured with a kit by a method including mutarotase and glucose oxidase (Wako Junyaku Co Ltd).
Experimental Series 3: Analysis of the
5'-Flanking Promoter Region of ET-1 Gene in
Cardiomyocytes
1. Plasmid construction for HIF-1 and ARNT
expression: A full length of rat HIF-1 cDNA was amplified by use of
primers in the mouse HIF-1 DNA
sequence.21
2. Analysis of the promoter activity of the
ET-1 gene by luciferase assay with the coexpression of HIF-1 and
ARNT: Photunis control
luciferase vector (Nippon Gene Co Ltd) was used for plasmid
construction,16 which
contains the 5'-promoter region of the ET-1 gene (a reporter vector).
The 5'-flanking promoter region of the rat ET-1 gene, ie, -0.75-kb
5'-ET-1 (-750 to +60), was amplified by PCR from rat genomic DNA by
primers as follows: -0.75-kb 5'-ET-1 sense: 5'-TCGGATCCTCCCCTGGT-
TTGAATC-3'; and -0.75-kb 5'-ET-1 antisense:
5'-GAGGATCCTGTT-TCTGGAGACTCCT-3'.
As a control, we used control luciferase vector (control vector), which did not possess -0.75-kb 5'-ET-1. We performed transfection experiments 5 times, each experiment in triplicate.
3. Transfection of primary cultured
cardiomyocytes with cationic reagents: The primary cultured
cardiomyocytes were transfected by a cationic reagent,
LipofectAmine (Life Technologies), as shown in our previous
study.16 Examples of
transfection experiments are (a) control vector:
cardiomyocytes transfected by control vector; (b) control
vector+ARNT: cardiomyocytes transfected by ARNT and control
vector; (c) control vector+HIF-1: cardiomyocytes
transfected by HIF-1 and control vector; (d) control
vector+HIF-1+ARNT: cardiomyocytes transfected by
HIF-1, ARNT, and control vector; (e) reporter vector:
cardiomyocytes transfected by the reporter vector; (f)
reporter vector+ARNT: cardiomyocytes transfected by the
reporter vector and ARNT; (g) reporter vector+HIF-1:
cardiomyocytes transfected by the reporter vector and
HIF-1; and (h) reporter vector+HIF-1+ARNT:
cardiomyocytes transfected by the reporter vector,
HIF-1, and ARNT.
After transfection, luciferase activity was measured by a luminometer according to the manufacturer’s instructions (Nippon Gene Co Ltd).
4. Electrophoretic mobility shift assay (EMSA):
Primary cultured cardiomyocytes were transfected by
HIF-1 expression vector. HIF-1–expressing rat
cardiomyocytes or nontransfected cardiomyocytes
as a negative control were used for EMSA. The nuclear extract samples
were incubated22 with an
-32P end-radiolabeled 39-bp probe,
5'-TTACGCGTCCGGCTGCACGTTGCCTGTGGGTACGCGTGG-3', which included HIF-1
binding site, in the presence of a 100 times greater amount of the
nonradiolabeled probe or a point-mutated probe
(5'-TTACGCGTCCGGCTGCAAAATGCCTGTGGGTACGCGTGG-3').
Experimental Series 4: Analysis of
Endothelin-1 Gene Expression Treated by Antisense
Oligonucleotide for HIF-1
We prepared antisense oligonucleotide
for HIF-1. As a control, scramble oligonucleotide is
also prepared as follows: antisense
oligonucleotide: CCTCCATGGCGAATCGGTGC; scramble
oligonucleotide: ACTCGTACCGCGGCAGTTCG.
The antisense or scramble oligonucleotide (7.5 µmol/L each) was added to primary cultured cardiomyocytes by use of Lipofectin (Life Technologies) and incubated for 6 hours, followed by 48 hours of incubation with ordinary culture medium. Six hours before RNA isolation (ie, 42 to 48 hours of incubation), antisense oligonucleotide, scramble oligonucleotide, or non–Lipofectin-treated cardiomyocytes were treated with 100 µmol/L CoCl2. Total RNA was isolated for RT-PCR.
Statistical Analysis
All data are presented as the mean±SEM.
Differences were analyzed by ANOVA with post hoc
analysis and the unpaired Student’s
t test. The results were
considered statistically significant at a value of
P<0.05.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Experimental Series 1: HIF-1
Gene Expression
in the Heart Is Progressively Increased in Parallel With an Increase in
ET-1 Gene Expression in Heart Failure In VivoAs shown in Table 1
, hemodynamic examination
revealed that the rats developed heart failure.
Figure 1A shows that HIF-1 mRNA expression increased with
increasing ET-1 mRNA in the post–myocardial infarction failing hearts
at 3 weeks (P<0.05 versus
control, n=6). At 12 weeks, HIF-1 mRNA was further increased
(P<0.05 versus control, n=6),
with increased ET-1 mRNA in comparison with a control.
|
|
P<0.05 vs HIF-1
As shown in
Table 2, at 30 weeks of age, CHF146 hamsters developed
heart failure. In this setting, HIF-1 mRNA expression was increased
(P<0.05 versus control, n=8)
with increased ET-1 mRNA expression
(P<0.05 versus control, n=8)
(Figure 1B
). As shown in
Table 2, at 62 weeks of age, CHF146 hamsters showed
a marked increase in left ventricular
end-diastolic pressure and central venous pressure. In the
62-week-old CHF146 hamsters, the expression of HIF-1 mRNA in the
heart progressively increased with increased ET-1 mRNA expression
compared with each expression level in 30-week-old CHF146 hamsters
(P<0.05 versus 30 weeks of age
and control, n=8) (P value
calculated by ANOVA with post hoc analysis)
(Figure 1B).
|
Experimental Series 2: Mitochondrial
Dysfunction Induced by Chemical Reagents Causes Increases in the Gene
Expression of HIF-1 and ET-1 in Cardiomyocytes In Vitro
To further investigate the mechanism by which HIF-1
mRNA and ET-1 mRNA are increased in parallel fashion, we performed an
in vitro study with cultured cardiomyocytes with
CoCl2, which causes mitochondrial
dysfunction.10 17 18
In
Figure 2A, the MTT reduction activity level was decreased by
24 hours of CoCl2 (100 µmol/L) treatment to
28% of the control level (n=5). Under this condition, glucose
consumption was reciprocally increased to 321% of that in nontreated
cardiomyocytes (n=4)
(Figure 2B).
Figure 2C shows that the ATP level was slightly decreased by
24 hours of CoCl2 treatment (n=3).
|
In CoCl2-treated
cardiomyocytes, HIF-1 mRNA expression was increased
(n=5)
(Figure 3A), accompanied by an increase in glucose
consumption
(Figure 2B). Under this condition, ET-1 mRNA was also
markedly increased (n=5)
(Figure 3B). The parallel increases in HIF-1 mRNA and ET-1
mRNA expression were associated with an increase in ANP mRNA expression
(n=5)
(Figure 3C). Furthermore, it was observed that 1 µmol/L
rotenone, a mitochondrial complex I inhibitor, also
increases HIF-1 mRNA and ET-1 mRNA expression as well as glucose
consumption (data not shown).
|
Experimental Series 3: Promoter
Activity of 5'-ET-1 Is Increased by HIF-1 in Primary Cultured
Cardiomyocytes
To investigate whether HIF-1 transcriptionally
regulates ET-1 gene expression, luciferase analysis using
5'-ET-1 was performed, because 5'-ET-1 possesses the HIF-1 binding
site [5'-(A/G)CGTG-3']
(Figure 4A).
Figure 4B showed that the activity increased markedly, by
14.8-fold, with addition of HIF-1 expression vector. Cotransfection
with both HIF-1 expression vector and ARNT expression vector
increased the promoter activity tremendously, to 30.6-fold, compared
with that of the reporter vector alone. This marked enhancement of
promoter activity by the cotransfection suggests that HIF-1
recognizes a specific element in the promoter region of the ET-1 gene
and transcriptionally activates ET-1 gene
expression.
|
HIF-1 Binds to the Regulatory
Region of the ET-1 Gene
To further clarify whether HIF-1 interacts with the
HIF-1 binding site in the promoter region of the ET-1 gene, EMSA was
performed with 39-bp radiolabeled probe possessing the predicted
HIF-1 binding site (n=3) (arrow in
Figure 4A). In
Figure 5, the nuclear extract from the
non–HIF-1–transfected cardiomyocytes (nontransfectant)
does not show a complex with the radiolabeled probe (lane 1). Nuclear
extract from HIF-1 transfectant showed the complex, however (lane
2). This complex was not altered by the point-mutated competitor (lane
3). The competitor with HIF-1 binding site, however, inhibited the
complex formation (lane 4). This result suggests that HIF-1 binds to
the DNA element in 5'-ET-1 and that HIF-1 is involved in the gene
expression of ET-1 as a transcriptional factor.
|
Experimental Series 4: Antisense
Oligonucleotide for HIF-1 Largely Prevents a
CoCl2-Induced Increase in ET-1 Gene
Expression in Cardiomyocytes
As shown in
Figure 6, in cardiomyocytes treated for 6 hours
with CoCl2, the antisense
oligonucleotide for HIF-1 showed a prevention of an
increase in gene expression of ET-1 in comparison with
CoCl2 alone or scramble
oligonucleotide–treated cardiomyocytes.
These data provide conclusive evidence that HIF-1 plays an
obligatory role for ET-1 induction.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
In the present study, we focused on the impaired energy metabolism of the failing heart, with the hypothesis that HIF-1
is responsible for the upregulation of ET-1 gene
expression, because it has been reported that ß-oxidation is impaired
in heart failure with downregulation of the key enzyme genes of
ß-oxidation.8 It is also
reported that glycolysis may alternatively be increased in heart
failure in the impairment of
ß-oxidation.9 Furthermore,
it has been reported that HIF-1 is an important transcriptional
factor for the induction of glycolytic enzyme genes, because the key
enzymes in glycolysis have been shown to possess the HIF-1 binding
site in the promoter
region.10 11 The
present study revealed for the first time that (1) an HIF-1
binding site exists in the 5'-promoter region of the ET-1 gene; (2)
HIF-1 directly binds to this promoter region, as demonstrated by
EMSA; (3) HIF-1 transcriptionally activates ET-1 gene
expression, as demonstrated by luciferase assay; (4) gene expression of
HIF-1 and ET-1 in the failing heart progressively increases during
the aggravation of heart failure in vivo in 2 models; and (5) antisense
oligonucleotide of HIF-1 largely prevents an
increase in cardiac ET-1 gene expression. Consequently, the present
study suggests a novel molecular mechanism of upregulation of ET-1
expression in heart failure, ie, impairment of cardiac energy
metabolism leading to activation of glycolysis is involved
in a marked increase in ET-1 gene expression through the
transcriptional factor HIF-1. Therefore, the present study may
present a relevant and novel insight to understanding the mechanism
of upregulation of cardiac ET-1 gene expression.
These findings were supported by the results of in vitro
study, ie, cardiomyocytes treated with a mitochondrial
inhibitor causing a switch in energy metabolism
from ß-oxidation to glycolysis. In the present study, 6 hours of
treatment with CoCl2 was performed, because we
confirmed that cultured cardiomyocytes were viable under
this condition. We also observed that 72 hours of treatment with
CoCl2 finally causes
apoptosis.19
Therefore, in the present conditions, cardiomyocytes
were in a preapoptotic phase. The point we addressed is that
cardiomyocytes increase gene expression of not only
HIF-1 but also ET-1 in the preapoptotic phase. Furthermore,
a demonstration that antisense oligonucleotide for
HIF-1 prevents increased ET-1 gene expression provides conclusive
evidence that HIF-1 plays an obligatory role in ET-1 gene expression
in cardiomyocytes.
It has been reported that some factors, ie, growth factors,
vasoactive substances, and mechanical stress, are involved in the
increase in ET-1 gene expression in the failing
heart.1 In addition to these
factors, the present study revealed that enhanced glycolysis
regulated by HIF-1 plays a crucial role for induction of ET-1.
Because ET-1 is known to increase cardiac muscle
contractility,1
ET-1 possesses some adaptive aspect of supporting
contractility of the failing
heart.1 ET-1 also exerts
unfavorable effects, however, such as myocardial
hypertrophy.1 3
Therefore, persistent increases in cardiac ET-1 expression in the
failing heart have a pathophysiologically
maladaptive aspect. Indeed, it has also been reported that long-term
treatment with an endothelin receptor antagonist
ameliorates the survival and/or hemodynamics of
patients and animal models with heart
failure.5 6 7 23 24
Therefore, it is suggested that the present study presents a
novel concept that this maladaptive response of cardiac ET-1 expression
is induced by the adaptive response of HIF-1 for the activation of
glycolysis in heart failure.
This study has the following limitations. The in vitro study
showed that antisense oligonucleotide for HIF-1
prevented a CoCl2-induced increase in ET-1 gene
expression, suggesting that HIF-1 plays an important role in this
increase in ET-1. It is possible, however, that another factor is also
involved in an increase in ET-1 mRNA in the cultured
cardiomyocytes under the present conditions.
Furthermore, although gene expression of HIF-1 and ET-1 in the
failing heart increased during the aggravation of heart failure in vivo
in 2 models, the in vivo study experiments provide only correlative
data with respect to HIF-1 and ET-1. In the present in vitro
experiments, we directly revealed, by antisense
oligonucleotide experiments, the crucial role of
HIF-1 in the upregulation of the ET-1 gene. In the in vivo model,
however, unlike the in vitro model, it is difficult to perform an
experiment that discloses directly whether HIF-1 regulates the
transcription of ET-1 gene expression, and therefore, we set this in
vivo situation as a study limitation.
In conclusion, the present study revealed a novel
molecular mechanism of upregulation of cardiac ET-1 in heart failure:
that HIF-1 is profoundly involved in induction of the glycolytic
system for the compensation of downregulated ß-oxidation of fatty
acid; alternatively, as a maladaptive aspect, such an induction of
HIF-1 causes elevation of cardiac ET-1 expression, which leads to
aggravation of heart
failure.
|
Acknowledgments |
|---|
This work was supported by grants-in-aid for scientific research from the Ministry of Education, Science, Sports and Culture of Japan (0006887, 10670629, 11357019, 11557047, 11770346, and 12470147) and by a grant from the Miyauchi project of Tsukuba Advanced Research Alliance (TARA) at the University of Tsukuba.
Received October 17, 2000; revision received December 31, 2000; accepted January 9, 2001.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
1. Miyauchi T, Masaki T. Pathophysiology of endothelin in the cardiovascular system. Annu Rev Physiol. 1999;61:391–415.[Medline] [Order article via Infotrieve]
2. Yanagisawa M, Kurihara H, Kimura H, et al. A novel potent vasoconstrictor peptide produced by vascular endothelial cells. Nature. 1988;332:411–415.[Medline] [Order article via Infotrieve]
3.
Miyauchi T,
Yorikane R, Sakai S, et al. Contribution of endogenous
endothelin-1 to the progression of cardiopulmonary alterations
in rats with monocrotaline-induced pulmonary hypertension.
Circ Res. 1993;73:887–897.
4.
Sakai S, Miyauchi
T, Sakurai T, et al. Endogenous endothelin-1 participates
in the maintenance of cardiac function in rats with congestive
heart failure: marked increase in endothelin-1 production in
the failing heart. Circulation. 1996;93:1214–1222.
5. Sakai S, Miyauchi T, Kobayashi M, et al. Inhibition of myocardial endothelin pathway improves long-term survival in heart failure. Nature. 1996;384:353–355.[Medline] [Order article via Infotrieve]
6.
Yamauchi-Kohno R,
Miyauchi T, Hoshino T, et al. Role of endothelin in deterioration of
heart failure due to cardiomyopathy in hamsters:
increase in endothelin-1 production in the heart and beneficial
effect of endothelin A antagonist on survival and cardiac
function. Circulation. 1999;99:2171–2176.
7.
Spinale FG, Walker
JD, Mukherjee R, et al. Concomitant endothelin receptor subtype-A
blockade during the progression of pacing-induced congestive heart
failure in rabbits: beneficial effects on left ventricular
and myocyte function.
Circulation. 1997;95:1918–1929.
8.
Sack MN, Rader TA,
Park S, et al. Fatty acid oxidization enzyme gene expression is
downregulated in the failing heart.
Circulation. 1996;94:2837–2842.
9.
Recchia FA,
McConnell PI, Bernstein RD, et al. Reduced nitric oxide
production and altered myocardial metabolism during
the decompensation of pacing-induced heart failure in the conscious
dog. Circ Res. 1998;83:969–979.
10.
Semenza GL, Roth
PH, Fang HM, et al. Transcriptional regulation of genes encoding
glycolytic enzymes by hypoxia-inducible factor 1.
J Biol Chem. 1994;269:23757–23763.
11. Semenza GL. Transcriptional regulation by hypoxia-inducible factor 1. Trends Cardiovasc Med. 1996;6:151–157.
12.
Wang GL, Semenza
GL. General involvement of hypoxia-inducible factor 1 in
transcriptional response to hypoxia.
Proc Natl Acad Sci
U S A. 1993;90:4304–4308.
13. Semenza GL. Regulation of erythropoietin production: new insights into molecular mechanisms of oxygen homeostasis. Hematol Oncol Clin N Am. 1994;8:P863–P884.
14. Forsythe JA, Jiang BH, Iyer NV, et al. Activation of vascular endothelial growth factor gene transcription by hypoxia-inducible factor 1. Mol Cell Biol. 1996;16:4604–4613.[Abstract]
15.
Haleen SJ,
Weishaar RE, Overhiser RW, et al. Effects of quinapril, a new
angiotensin converting enzyme inhibitor, on
left ventricular failure and survival in the
cardiomyopathic hamster.
Circ Res. 1991;68:1302–1312.
16. Kakinuma Y, Miyauchi T, Kobayashi T, et al. Myocardial expression of endothelin-2 is altered reciprocally to that of endothelin-1 during ischemia of cardiomyocytes in vitro and during heart failure in vivo. Life Sci. 1999;65:1671–1683.[Medline] [Order article via Infotrieve]
17. Ramsay RR, Singer TP. Relation of superoxide generation and lipid peroxidation to the inhibition of NADH-Q oxidoreductase by rotenone, piericidin A, and MPP+. Biochem Biophys Res Commun. 1992;189:47–52.[Medline] [Order article via Infotrieve]
18. Weiberg GS. The effect of cobalt ions on energy metabolism in the rat. Can J Biochem Physiol.. 1968;46:549–554.
19. Kakinuma Y, Miyauchi T, Yuki K, et al. Mitochondrial dysfunction of cardiomyocytes causing an impairment of cellular energy metabolism induces apoptosis, which is accompanied by an increase in cardiac ET-1 expression. J Cardiovasc Pharmacol. 2000;36:S201–S204.[Medline] [Order article via Infotrieve]
20.
Weiqiong LW,
Markovich R, Chen JW, et al. Regulation of cardiomyocyte
apoptotic signaling by insulin-like growth factor I.
Circ Res. 1998;83:516–522.
21.
Wenger RH, Rolfs
A, Marti HH, et al. Nucleotide sequence, chromosomal
assignment and mRNA expression of mouse hypoxia-inducible
factor-1. Biochem Biophys Res
Commun. 1996;223:54–59.[Medline]
[Order article via Infotrieve]
22.
Schreiber E,
Matthias P, Muller MM, et al. Rapid detection of octamer binding
proteins with "mini-extracts," prepared from a small number of
cells. Nucleic Acids Res. 1989;17:6419.
23. Packer M, Caspi A, Charlon V, et al. Multicenter, double blind, placebo-controlled study on long term endothelin blockade with bosentan in chronic heart failure: results of the REACH-1 trial. Circulation. 1998;98(suppl I):I-3. Abstract.
24.
Sutsch S,
Kiowski W, Yan XW, et al. Short-term oral endothelin-receptor
antagonist therapy in conventionally treated patients with
symptomatic severe chronic heart failure.
Circulation. 1998;98:2262–2268.
This article has been cited by other articles:
 |
|
 |
|
  S. de Frutos, L. Duling, D. Alo, T. Berry, O. Jackson-Weaver, M. Walker, N. Kanagy, and L. Gonzalez Bosc NFATc3 is required for intermittent hypoxia-induced hypertension Am J Physiol Heart Circ Physiol, May 1, 2008; 294(5): H2382 - H2390. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Yamashita, O. Ohneda, M. Nagano, M. Iemitsu, Y. Makino, H. Tanaka, T. Miyauchi, K. Goto, K. Ohneda, Y. Fujii-Kuriyama, et al. Abnormal Heart Development and Lung Remodeling in Mice Lacking the Hypoxia-Inducible Factor-Related Basic Helix-Loop-Helix PAS Protein NEPAS Mol. Cell. Biol., February 15, 2008; 28(4): 1285 - 1297. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Mikaelian, D. Coluccio, K. T. Morgan, T. Johnson, A. L. Ryan, E. Rasmussen, R. Nicklaus, C. Kanwal, H. Hilton, K. Frank, et al. Temporal Gene Expression Profiling Indicates Early Up-regulation of Interleukin-6 in Isoproterenol-induced Myocardial Necrosis in Rat Toxicol Pathol, February 1, 2008; 36(2): 256 - 264. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. P. Lourenco, R. Roncon-Albuquerque Jr., C. Bras-Silva, B. Faria, J. Wieland, T. Henriques-Coelho, J. Correia-Pinto, and A. F. Leite-Moreira Myocardial dysfunction and neurohumoral activation without remodeling in left ventricle of monocrotaline-induced pulmonary hypertensive rats Am J Physiol Heart Circ Physiol, October 1, 2006; 291(4): H1587 - H1594. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Kobayashi, H. Oku, M. Fukuhara, S. Kojima, A. Komori, M. Ichikawa, K. Katsumura, M. Kobayashi, T. Sugiyama, and T. Ikeda Endothelin-1 Enhances Glutamate-Induced Retinal Cell Death, Possibly through ETA Receptors Invest. Ophthalmol. Vis. Sci., December 1, 2005; 46(12): 4684 - 4690. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Hocher, P. Kalk, T. Slowinski, M. Godes, A. Mach, S. Herzfeld, D. Wiesner, P. C. Arck, H.-H. Neumayer, and B. Nafz ETA Receptor Blockade Induces Tubular Cell Proliferation and Cyst Growth in Rats with Polycystic Kidney Disease J. Am. Soc. Nephrol., February 1, 2003; 14(2): 367 - 376. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. J. Scheubel, M. Tostlebe, A. Simm, S. Rohrbach, R. Prondzinsky, F. N. Gellerich, R.-E. Silber, and J. Holtz Dysfunction of mitochondrial respiratory chain complex I in human failing myocardium is not due to disturbed mitochondrial gene expression J. Am. Coll. Cardiol., December 18, 2002; 40(12): 2174 - 2181. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Tham, J. Wang, F. Piehl, and G. Weber Upregulation of VEGF-A Without Angiogenesis in a Mouse Model of Dilated Cardiomyopathy Caused by Mitochondrial Dysfunction J. Histochem. Cytochem., July 1, 2002; 50(7): 935 - 944. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C.-H. Kim, Y.-S. Cho, Y.-S. Chun, J.-W. Park, and M.-S. Kim Early Expression of Myocardial HIF-1{alpha} in Response to Mechanical Stresses: Regulation by Stretch-Activated Channels and the Phosphatidylinositol 3-Kinase Signaling Pathway Circ. Res., February 8, 2002; 90 (2): e25 - e33. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. D. Kline, Y.-J. Peng, D. J. Manalo, G. L. Semenza, and N. R. Prabhakar Defective carotid body function and impaired ventilatory responses to chronic hypoxia in mice partially deficient for hypoxia-inducible factor 1alpha PNAS, January 22, 2002; 99(2): 821 - 826. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C.-H. Kim, Y.-S. Cho, Y.-S. Chun, J.-W. Park, and M.-S. Kim Early Expression of Myocardial HIF-1{alpha} in Response to Mechanical Stresses: Regulation by Stretch-Activated Channels and the Phosphatidylinositol 3-Kinase Signaling Pathway Circ. Res., February 8, 2002; 90 (2): e25 - e33. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||