Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation
Search: search_blue_button Advanced Search
Circulation. 2000;102:452-457

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yamashita, N.
Right arrow Articles by Hori, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yamashita, N.
Right arrow Articles by Hori, M.
Related Collections
Right arrow Growth factors/cytokines

(Circulation. 2000;102:452.)
© 2000 American Heart Association, Inc.


Basic Science Reports

Involvement of Cytokines in the Mechanism of Whole-Body Hyperthermia-Induced Cardioprotection

Nobushige Yamashita, MD, PhD; Shiro Hoshida, MD, PhD; Kinya Otsu, MD, PhD; Naoyuki Taniguchi, MD, PhD; Tsunehiko Kuzuya, MD, PhD; Masatsugu Hori, MD, PhD

From the First Department of Medicine (N.Y., S.H., K.O., T.K., M.H.), Department of Pathophysiology (T.K.), and Department of Biochemistry (N.T.), Osaka University Medical School, and the Cardiovascular Division, Osaka Rosai Hospital (S.H.), Osaka, Japan.

Correspondence to Shiro Hoshida, MD, PhD, Cardiovascular Division, Osaka Rosai Hospital, 1179-3 Nagasone-cho, Sakai, Osaka 591-8025, Japan. E-mail hoshidas{at}orh.go.jp


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Background—Hyperthermia increases cardiac tolerance to ischemia/reperfusion injury and activates manganese superoxide dismutase (Mn-SOD), an intrinsic radical scavenger, in myocardium in a biphasic manner. Tumor necrosis factor-{alpha} (TNF-{alpha}) and interleukin-1ß (IL-1ß) induced a biphasic cardioprotection that corresponded to the activation of Mn-SOD. However, a direct association between Mn-SOD activation in myocardium and the acquisition of tolerance to ischemia/reperfusion injury induced by hyperthermia and the involvement of the cytokines in the signal transduction pathway for the hyperthermia-induced cardioprotection have not yet been elucidated.

Methods and Results—Hyperthermia was induced in anesthetized rats by placement in a temperature-controlled water bath. At 0.5 and 72 hours after hyperthermia, ischemia was induced by occlusion of the left coronary artery for 20 minutes, followed by reperfusion for 48 hours. Inhibition of the increases in Mn-SOD content and activity 72 hours after hyperthermia by the administration of antisense oligodeoxynucleotides to Mn-SOD abolished the expected decrease in myocardial infarct size. The simultaneous administration of neutralizing antibodies to TNF-{alpha} and IL-1ß before hyperthermia abolished the biphasic cardioprotection and increase in Mn-SOD activity.

Conclusions—The increase in Mn-SOD activity mediated through the production of TNF-{alpha} and IL-1ß by whole-body hyperthermia is important in the acquisition of early- and late-phase cardioprotection against ischemia/reperfusion injury in rats.


Key Words: enzymes • hormones • interleukins • hyperthermia • genes


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Cardiac resistance to ischemia/reperfusion injury is increased by exposure to sublethal stress, such as a brief period of ischemia, exercise, or whole-body hyperthermia in a biphasic manner.1 2 3 4 Tolerance after exposure to whole-body hyperthermia is manifested both soon after and 24 to 72 hours after hyperthermia.4 We reported that the time course of manganese superoxide dismutase (Mn-SOD) activation in myocardium corresponded to that of the biphasic cardioprotective effects after hyperthermia, and an increase in the content of Mn-SOD appeared to be responsible for the activation of the enzyme at the late phase.4 Direct proof that the activation and induction of this protein led to the acquisition of tolerance to ischemia/reperfusion injury, however, has not yet been presented.

Tumor necrosis factor-{alpha} (TNF-{alpha}) and interleukin-1 (IL-1) are known as potent inducers of Mn-SOD.5 6 We and others reported that the administration of TNF-{alpha} and IL-1ß induced cardioprotection against ischemia/reperfusion injury 24 to 48 hours after the treatment.3 7 8 9 We also reported that the time course of the cytokine-induced cardioprotection exhibited a biphasic pattern similar to that for the activation of Mn-SOD.3 Moreover, the production of TNF-{alpha} and IL-1ß during exercise plays a pivotal role in exercise-induced cardioprotection through the activation and induction of Mn-SOD.3 Neta et al10 reported that radioresistance induced by lipopolysaccharide depended on induction of TNF and IL-1, because blocking the activities of these 2 cytokines completely abolished the radioprotective effect of lipopolysaccharide.

In the present study, we attempted to demonstrate a direct association between the acquisition of tolerance to ischemia/reperfusion injury and Mn-SOD activation in myocardium induced by whole-body hyperthermia, using a rat model of occlusion-reperfusion in the left coronary artery (LCA). We also examined whether the cytokines were involved in the mechanism of hyperthermia-induced cardioprotection.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
This study was carried out under the supervision of the Animal Research Committee in accordance with the Guideline on Animal Experiments of Osaka University and the Japanese Government Animal Protection and Management Law (No. 105).

Animals and Experimental Protocol
Male Wistar rats (300 to 350 g) were maintained on a 12-hour dark/light cycle, housed at 23±1.5°C (45±15% relative humidity), and allowed access to water and rat chow ad libitum. After the induction of light anesthesia with sodium pentobarbital 5 to 10 mg/kg IP, whole-body hyperthermia was induced by placing the rats in a constant-temperature water bath as described previously.4 11 During whole-body hyperthermia, the animal was supported by a wire apparatus to prevent the aspiration of water and to facilitate the measurement of rectal temperature. Hyperthermia was maintained at 42±0.2°C for 15 minutes (Figure 1Down). Rats in the sham-treated control group were placed in a water bath maintained at 36.5±0.2°C.4 Rats were allowed to recover at room temperature for defined intervals before the induction of myocardial infarction. Some rats received neither hyperthermic nor normothermic water-bath treatment (untreated control).



View larger version (14K):
[in this window]
[in a new window]
 
Figure 1. Experimental protocol. Anesthetized rats were placed in water baths at 42±0.2°C for 15 minutes and allowed to recover for 0.5 and 72 hours before initiation of cardiac ischemia induced by ligation of LCA. Animals were euthanized 48 hours after restoration of cardiac perfusion. ASODN, SODN, or scrambled ODN was administered IP just after hyperthermia. TNF-{alpha} and/or IL-1ß antibodies were infused IP 30 minutes before immersion in water bath.

Infarction Protocol
The surgical procedures of occlusion-reperfusion by LCA occlusion in rats were described previously.4 At the end of the recovery intervals, rats were anesthetized with sodium pentobarbital (25 mg/kg IP), intubated, and ventilated with a small-animal respirator at a rate of 60 to 70 cycles/min and a tidal volume of 1 mL/100 g body wt. The right femoral artery was cannulated with polyethylene tubing for the continuous measurement of arterial blood pressure with a pressure transducer. The heart rate, incidence of arrhythmias, and ST-segment changes were monitored. Hemodynamic variables were recorded continuously. After a 10-minute period of stabilization, measurement of arterial pressure was initiated and the LCA was ligated. After 20 minutes of coronary occlusion, the snare was released. The surgical wounds were repaired 60 minutes after reperfusion, and the rats were returned to individual cages to recover. Rats were reanesthetized with sodium pentobarbital (25 mg/kg IP) 48 hours after reperfusion and were intubated and ventilated with the respirator. After the heart was exposed and the LCA was reoccluded, Evans blue dye (2%) was injected via the right femoral vein to estimate the area perfused by the occluded artery (ischemic region). Rats were killed by an overdose of sodium pentobarbital. The left ventricle was then cut into 6 pieces perpendicular to the apex-base axis. These specimens were incubated with 1% triphenyltetrazolium chloride at 37°C to stain the noninfarcted region. The ischemic, infarcted, and nonischemic areas of tissue were separated with scissors and weighed.11 12 The area at risk and the infarct size were defined as the ratios of the mass of the ischemic region to the left ventricular mass and the mass of the infarct region to that of the ischemic region, respectively, and were expressed as percentages. This procedure of infarct size measurement was performed in a blinded fashion.

Arrhythmias were monitored by ECG. Ventricular fibrillation (VF) was defined according to the criteria of the Lambeth Conventions.13 If VF occurred and did not resolve spontaneously within 3 seconds, manual cardioversion was attempted by gentle flicking of the nonischemic region of the heart. Rats in which VF continued for >6 seconds or cardioversion had to be performed >3 times were excluded from infarct size analysis.

Myocardial Tissue Sampling
To obtain tissue samples for measurements of Mn-SOD content and activity, rats were killed by an overdose of sodium pentobarbital. The myocardial tissue was rinsed in PBS, and then blood in the left and right coronary arteries was washed out with an adequate volume of PBS from the ascending aorta retrogradely. Both atria and the right ventricle were removed, and left ventricular myocardial samples were rapidly frozen by immersion in liquid nitrogen and stored at -80°C until use.4

Measurement of Activity and Content of Mn-SOD
Myocardial levels of Mn-SOD activity and content were determined in rats euthanized after recovery intervals of 0.5 and 72 hours after water-bath treatment and in untreated control rats. Mn-SOD activity of the myocardial samples was determined by the nitroblue tetrazolium method.3 4 Mn-SOD content in rats of the untreated control, sham-treated control, and hyperthermia groups was measured by an ELISA, as reported previously.3 4 14 The activity and content of Mn-SOD were expressed relative to the protein concentration in the supernatant determined by the method of Lowry.

Administration of the Reagents
The phosphorothioated oligodeoxynucleotides were purchased from Bex. A 22-mer phosphorothioated derivative of antisense oligodeoxynucleotides (ASODN, CACGCCGCCCGACACAACATTG) to Mn-SOD, sense oligodeoxynucleotides (SODN, CAATGTTGTGTCGGGCGGCGTG) to Mn-SOD, or scrambled oligonucleotide (TCTCAGTGAGAGCCCTCATTCTGT) was injected just after whole-body hyperthermia at a dose of 10 mg/kg IP.3 Anti-murine TNF-{alpha} antibody (0.5 mL IP) and/or anti-murine IL-1ß antibody (0.5 mg IP) was infused 30 minutes before whole-body hyperthermia.3 Polyclonal rabbit anti-murine TNF-{alpha} antibody and monoclonal hamster anti-murine IL-1ß antibody were obtained from Genzyme. Both antibodies cross-react with rat cytokines.15 16

Materials
Chemicals were purchased from Sigma Immunochemicals and Wako Fine Chemicals.

Statistics
Data are expressed as mean±SEM. The significance of the differences between groups was assessed by 1-way ANOVA with Bonferroni’s post hoc test for multiple comparisons. A level of P<0.05 was considered statistically significant.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Exclusion Because of VF or Death
A total of 6 rats developed serious VF during occlusion (1 in the untreated control group, 2 in the sham-treated control group, 2 in the hyperthermia group treated with ASODN, and 1 in the hyperthermia group pretreated with TNF-{alpha} and IL-1ß antibodies) and were excluded from the evaluation of myocardial infarct size. Six rats died prematurely (probably because of arrhythmia or heart failure) during the 48-hour reperfusion period (1 in the untreated control group, 2 in the sham-treated control group, 1 in the hyperthermia group, 1 in the hyperthermia group treated with ASODN, and 1 in the hyperthermia group pretreated with TNF-{alpha} and IL-1ß antibodies).

Hemodynamic Data and Rectal Temperature
No significant differences were observed in the rate-pressure product or in the rectal temperature during the infarct protocol among the groups before ischemia, at the end of the ischemic period, or 0.5 hour after reperfusion (data not shown).

Direct Relationship Between Cardioprotection and Induction of Mn-SOD
We examined the relationship between the acquisition of tolerance to ischemia/reperfusion and the induction of Mn-SOD in the myocardium 72 hours after whole-body hyperthermia. We manipulated the level of expression of Mn-SOD using ASODN that corresponded to the initiation site of Mn-SOD translation. This reagent was administered intraperitoneally to rats immediately after whole-body hyperthermia. There were no significant differences in myocardial Mn-SOD activity and content between the untreated control group and the sham-treated control group with 72-hour recovery (Figure 2Down). As we previously reported,4 Mn-SOD activity and content in the hyperthermia group increased at the 72-hour recovery interval (Figures 2Down and 5Down). The administration of ASODN completely inhibited the increases in Mn-SOD activity and content 72 hours after hyperthermia (Figure 2Down). However, SODN or scrambled ODN did not attenuate the increases in Mn-SOD activity and content induced by hyperthermia (Figure 2Down).



View larger version (69K):
[in this window]
[in a new window]
 
Figure 2. Effects of hyperthermia and ODN on Mn-SOD activity and content in rat myocardium. Activity of Mn-SOD was determined by nitroblue tetrazolium, and content was determined by ELISA in cardiac tissue homogenates from rats exposed to treatments as described in Figure 1Up. C indicates untreated control group (n=5); Sham, sham-treated control group with 72-hour recovery (n=5); WH, rats from whole-body hyperthermia group with 72-hour recovery (n=5); WH+Sense ODN, 72-hour-recovery rats receiving sense ODN just after hyperthermic treatment (n=4); WH+Scrambled ODN, 72-hour-recovery rats receiving scrambled ODN just after hyperthermic treatment (n=4); and WH+Antisense ODN, 72-hour-recovery rats receiving antisense ODN just after hyperthermic treatment (n=4). Rats in control (sham-treated and untreated) and hyperthermia groups received saline IP just before 72-hour-recovery period. Data are expressed as mean±SEM. *P<0.05 vs sham-treated control rats; #P=NS vs sham-treated control rats by ANOVA with Bonferroni’s post hoc test for multiple comparisons.



View larger version (52K):
[in this window]
[in a new window]
 
Figure 5. Effects of hyperthermia and TNF-{alpha} and/or IL-1ß antibodies on Mn-SOD activity in rat myocardium. Activity of Mn-SOD was determined by nitroblue tetrazolium in cardiac tissue homogenates from rats exposed to treatments as described in Figure 1Up. Groups are defined as in legend to Figure 4Up. Rats in sham-treated and hyperthermia groups received saline IP 30 minutes before sham treatment and hyperthermia, respectively. Data are expressed as mean±SEM of values from >=4 rats. *P<0.05 vs sham-treated control rats; #P=NS vs sham-treated control rats by ANOVA with Bonferroni’s post hoc test for multiple comparisons.

The size of the area at risk expressed as a percentage of left ventricular area did not differ significantly among the groups (Figures 3Down and 4Down). There was no significant difference in the size of the myocardial infarction between the sham-treated control group with 72 hours of recovery and the untreated control group (Figures 3Down and 4Down). The induction of whole-body hyperthermia reduced the size of myocardial infarction in rats 72 hours after hyperthermia (Figures 3Down and 4Down), in agreement with our previous report.4 As shown in Figure 3Down, the expected decrease in infarct size was abolished in rats treated with ASODN to Mn-SOD, in which the induction of Mn-SOD was specifically inhibited. SODN, which did not attenuate the induction of Mn-SOD in myocardium after hyperthermia, did not abolish the protective effect of whole-body hyperthermia. Administration of the scrambled ODN had no effect on infarct size as seen with SODN.



View larger version (54K):
[in this window]
[in a new window]
 
Figure 3. Effects of hyperthermic treatment and ODN on myocardial infarct size in rats. Infarct size was calculated as ratio of mass of infarct region to that of ischemic region in hearts from rats exposed to treatments as described in Figure 1Up. Groups are defined as in Figure 2Up. Rats in control (sham-treated and untreated) and hyperthermia groups received saline IP just before 72-hour recovery period. Infarct size in sham-treated control rats was not significantly different from that in untreated control rats. Number of rats used is indicated in each column (n=8 to 12 for each group). Data are mean±SEM. *P<0.05 vs sham-treated control rats; #P=NS vs sham-treated control rats by ANOVA with Bonferroni’s post hoc test for multiple comparisons.



View larger version (70K):
[in this window]
[in a new window]
 
Figure 4. Effects of hyperthermia and TNF-{alpha} and/or IL-1ß antibodies on infarct size in rats. Infarct size was calculated as ratio of mass of infarct region to mass of ischemic region after reperfusion in rats exposed to treatments as described in Figure 1Up. C indicates untreated control group; Sham, sham-treated control group; WH, rats from whole-body hyperthermia group; WH+TNF-{alpha} Ab, rats receiving TNF-{alpha} antibody before hyperthermic treatment; WH+IL-1ß Ab, rats receiving IL-1ß antibody before hyperthermic treatment; and WH+TNF-{alpha} & IL-1ß Ab, rats receiving TNF-{alpha} and IL-1ß antibodies before hyperthermic treatment. Rats in sham-treated and hyperthermia groups received saline IP 30 minutes before sham treatment and hyperthermia, respectively. Number of rats used is indicated in each column (n=8 to 13 for each group). Data are mean±SEM. *P<0.05 vs sham-treated control rats; #P=NS vs sham-treated control rats by ANOVA with Bonferroni’s post hoc test for multiple comparisons.

Involvement of Cytokines in Hyperthermia-Induced Cardioprotection
We reported that TNF-{alpha} and IL-1ß are involved in exercise-induced cardioprotection.3 To examine whether these cytokines contribute to the hyperthermia-induced cardioprotection, we administered neutralizing antibodies to these cytokines intraperitoneally 30 minutes before hyperthermia. There were no significant differences in infarct size among sham-treated control groups (0.5 and 72 hours after treatment) and the untreated control group (Figure 4Up). Administration of an antibody to TNF-{alpha} did not influence infarct size 0.5 or 72 hours after hyperthermia (Figure 4Up). The administration of an antibody to IL-1ß also did not alter the size of the myocardial infarct 0.5 or 72 hours after hyperthermia. However, simultaneous administration of the antibodies to TNF-{alpha} and IL-1ß abolished the protection against ischemic damage 0.5 and 72 hours after hyperthermia.

In myocardium from sham-treated control groups, Mn-SOD activity was unchanged 0.5 and 72 hours after treatment (Figure 5Up). Mn-SOD activity in the hyperthermia group increased at the 0.5- and 72-hour recovery intervals compared with that in the corresponding sham-treated control groups (Figure 5Up). The activity of the cytosolic isoform of SOD (Cu,Zn-SOD) did not change after hyperthermia (data not shown). Antibody to TNF-{alpha} or IL-1ß had no effect on the increase in Mn-SOD activity induced by hyperthermia (Figure 5Up). The simultaneous administration of the antibodies to these cytokines eliminated the increase in Mn-SOD activity 0.5 and 72 hours after hyperthermia (Figure 5Up) and abolished the increase in Mn-SOD content 72 hours after hyperthermia (data not shown).


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
We previously reported that exposure to hyperthermia led to a recovery interval–dependent, biphasic reduction in the size of the myocardial infarction as determined after 48 hours of reperfusion. The time course of the increase in myocardial Mn-SOD activity corresponded to that of the cardioprotection, whereas an increase in the content of Mn-SOD corresponded only to the late-phase effect.4 In this study, we found that (1) the expected decrease in infarct size at the early phase induced by hyperthermia was abolished in rats treated with neutralizing antibodies to TNF-{alpha} and IL-1ß, in which the increase in Mn-SOD activity was inhibited; and (2) manipulations including the administration of ASODN to Mn-SOD and neutralizing antibodies to TNF-{alpha} and IL-1ß, which inhibited the induction of Mn-SOD at the late phase, abolished the delayed protection against ischemia/reperfusion injury induced by hyperthermia. Taken together, these results indicated that Mn-SOD plays a central role in the protective effect of whole-body hyperthermia in both the early and late phases in rats. A mechanism for the activation of Mn-SOD at the early phase after hyperthermia, in which there was no difference in Mn-SOD at the protein level between hyperthermia and sham-treated control groups, remains to be elucidated.4 The increase in Mn-SOD activity disappeared by 3 hours after hyperthermia,4 suggesting that a rapid inactivation should follow the activation of Mn-SOD. The inhibition of Mn-SOD induction at the late phase by the administration of ASODN abolished the hyperthermia-induced cardioprotection. This result indicated that at the late phase, the induction of Mn-SOD leads to an increase in its enzyme activity, resulting in the acquisition of cardioprotection against ischemia/reperfusion injury.

In this study, neutralizing antibodies to TNF-{alpha} and IL-1ß, which inhibited the increase in Mn-SOD activity at the early and late phases and the induction of Mn-SOD at the late phase, abolished the biphasic cardioprotection against ischemia/reperfusion injury induced by whole-body hyperthermia. Because there is some redundancy in the effects of TNF-{alpha} and IL-1ß,17 18 blocking of TNF-{alpha} or IL-1ß by its antibody did not exhibit any effect in our system. We reported that the administration of TNF-{alpha} and IL-1ß induces biphasic cardioprotection and Mn-SOD activation in rats.3 These results suggest that both TNF-{alpha} and IL-1ß are involved in hyperthermia-induced cardioprotection via the increase in Mn-SOD activity. We reported that reactive oxygen species, which are produced during hyperthermia,19 induce an increase in Mn-SOD activity, resulting in biphasic hyperthermia-induced cardioprotection.4 The production of reactive oxygen species led to increases in TNF-{alpha} and IL-1ß in myocardium.3 Therefore, these data indicate that the production of TNF-{alpha} and IL-1ß, probably via the generation of reactive oxygen species during hyperthermia, is important in the increase in Mn-SOD activity after heat stress.

TNF-{alpha} and IL-1 cause rapid activation and nuclear translocation of the transcription factor nuclear factor (NF)-{kappa}B,20 21 22 which strongly correlate with the induction of Mn-SOD.23 It was recently reported that a cis-acting TNF-{alpha}– or IL-1ß–responsive element was identified for the Mn-SOD gene in mouse, and NF-{kappa}B binds to the element.24 The transcription factor NF-{kappa}B is subject to redox regulation.25 26 27 28 29 30 NF-{kappa}B might play a role in the cytokine-mediated Mn-SOD induction at the late phase. A mechanism of Mn-SOD activation by TNF-{alpha} and IL-1ß at the early phase, however, remains to be elucidated.

We reported that exercise induced a biphasic cardioprotection with the activation of Mn-SOD.3 Combined administration of the antibodies to TNF-{alpha} and IL-1ß abolished the biphasic cardioprotection induced by exercise.3 We also reported that reactive oxygen species produced during exercise are involved in the production of TNF-{alpha} and IL-1ß and the biphasic activation of Mn-SOD.3 Brief sublethal ischemic or anoxic insults also have been shown to increase Mn-SOD activity and to induce cardioprotection or myocyte protection in a biphasic manner.31 32 Mn-SOD is directly associated with the delayed protection of the myocyte against hypoxia-reoxygenation injury in an in vitro model.14 33 34 The acquisition of cardioprotection by sublethal stress, such as whole-body hyperthermia, exercise, or ischemia, may involve a common mechanism that functions through an induction and activation of Mn-SOD via the production of reactive oxygen species and cytokines.

Conclusions
Whole-body hyperthermia induced a biphasic increase in Mn-SOD activity and biphasic cardioprotection in rats. The administration of ASODN to Mn-SOD, which inhibited the induction of Mn-SOD at the late phase, abolished hyperthermia-induced delayed cardioprotection against ischemia/reperfusion injury. The neutralizing antibodies to TNF-{alpha} and IL-1ß, in which the increase in Mn-SOD activity was inhibited, abolished the expected decrease in infarct size induced by hyperthermia. These results suggest that TNF-{alpha} and IL-1ß are involved in hyperthermia-induced cardioprotection via the activation and induction of Mn-SOD.


*    Acknowledgments
 
This work was supported in part by research grants from the Ministry of Education, Science, and Culture of Japan (Drs Hoshida and Hori). We thank Dr Kei-ichiro Suzuki for providing polyclonal antibody to rat Mn-SOD.

Received September 29, 1999; revision received February 7, 2000; accepted February 29, 2000.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Kuzuya T, Hoshida S, Yamashita N, et al. Delayed effects of sublethal ischemia on the acquisition of tolerance to ischemia. Circ Res. 1993;72:1293–1299.[Abstract/Free Full Text]

2. Marber MS, Latchman DS, Walker JM, et al. Cardiac stress protein elevation 24 hours after brief ischemia or heat stress is associated with resistance to myocardial infarction. Circulation. 1993;88:1264–1272.[Abstract/Free Full Text]

3. Yamashita N, Hoshida S, Otsu K, et al. Exercise provides direct biphasic cardioprotection via manganese superoxide dismutase activation. J Exp Med. 1999;189:1699–1706.[Abstract/Free Full Text]

4. Yamashita N, Hoshida S, Taniguchi N, et al. Whole-body hyperthermia provides biphasic cardioprotection against ischemia/reperfusion injury in the rat. Circulation. 1998;98:1414–1421.[Abstract/Free Full Text]

5. Wong GHW, Goeddel DV. Induction of manganese superoxide dismutase by tumor necrosis factor: possible protective mechanism. Science. 1988;242:941–944.[Abstract/Free Full Text]

6. Masuda A, Longo DL, Kobayashi Y, et al. Induction of mitochondrial manganese superoxide dismutase by interleukin 1. FASEB J. 1988;2:3087–3091.[Abstract]

7. Brown JM, White CW, Terada LS, et al. Interleukin 1 pretreatment decreases ischemia/reperfusion injury. Proc Natl Acad Sci U S A. 1990;87:5026–5030.[Abstract/Free Full Text]

8. Eddy LJ, Goeddel DV, Wong GHW. Tumor necrosis factor-{alpha} pretreatment is protective in a rat model of myocardial ischemia-reperfusion injury. Biochem Biophys Res Commun. 1992;184:1056–1059.[Medline] [Order article via Infotrieve]

9. Nelson SK, Wong GHW, McCord JM. Leukemia inhibitory factor and tumor necrosis factor induce manganese superoxide dismutase and protect rabbit hearts from reperfusion injury. J Mol Cell Cardiol. 1995;27:223–229.[Medline] [Order article via Infotrieve]

10. Neta R, Oppenheim JJ, Schreiber RD, et al. Role of cytokines (interleukin 1, tumor necrosis factor, and transforming growth factor ß) in natural and lipopolysaccharide-enhanced radioresistance. J Exp Med. 1991;173:1177–1182.[Abstract/Free Full Text]

11. Yamashita N, Hoshida S, Nishida M, et al. Time course of tolerance to ischemia-reperfusion injury and induction of heat shock protein 72 by heat stress in the rat heart. J Mol Cell Cardiol. 1997;29:1815–1821.[Medline] [Order article via Infotrieve]

12. Yamashita N, Hoshida S, Taniguchi N, et al. A "second window of protection" occurs 24 h after ischemic preconditioning in the rat heart. J Mol Cell Cardiol. 1998;30:1181–1189.[Medline] [Order article via Infotrieve]

13. Walker MJ, Curtis MJ, Hearse DJ, et al. The Lambeth Conventions: guidelines for the study of arrhythmias in ischaemia, infarction, and reperfusion. Cardiovasc Res. 1988;22:447–455.[Medline] [Order article via Infotrieve]

14. Yamashita N, Nishida M, Hoshida S, et al. Induction of manganese superoxide dismutase in rat cardiac myocytes increases tolerance to hypoxia 24 hours after preconditioning. J Clin Invest. 1994;94:2193–2199.

15. Teti G, Mancuso G, Tomasello F. Cytokine appearance and effects of anti-tumor necrosis factor alpha antibodies in a neonatal rat model of group B streptococcal infection. Infect Immun. 1993;61:227–235.[Abstract/Free Full Text]

16. Wu X, Witter AJ, Carr LS, et al. Cytokine-induced neutrophil chemoattractant mediates neutrophil influx in immune complex glomerulonephritis in rat. J Clin Invest. 1994;94:337–344.

17. Aggarwal BB, Natarajan K. Tumor necrosis factor: developments during the last decade. Eur Cytokine Netw. 1996;7:93–124.[Medline] [Order article via Infotrieve]

18. Dinarello CA. Interleukin-1 and its biologically related cytokines. Adv Immunol. 1989;44:153.[Medline] [Order article via Infotrieve]

19. Salo DC, Donovan CM, Davies KJA. HSP70 and other possible heat shock or oxidative stress proteins are induced in skeletal muscle, heart, and liver during exercise. Free Radic Biol Med. 1991;11:239–246.[Medline] [Order article via Infotrieve]

20. Beg AA, Baldwin AS. Activation of multiple NF-{kappa}B/Rel DNA-binding complexes by tumor necrosis factor. Oncogene. 1994;9:1487–1492.[Medline] [Order article via Infotrieve]

21. Beg AA, Finco TS, Nantermet PV, et al. Tumor necrosis factor and interleukin-1 lead to phosphorylation and loss of I{kappa}B{alpha}: a mechanism for NF-{kappa}B activation. Mol Cell Biol. 1993;13:3301–3310.[Abstract/Free Full Text]

22. Osborn L, Kunkel S, Nabel GJ. Tumor necrosis factor alpha and interleukin 1 stimulate the human immunodeficiency virus enhancer by activation of the nuclear factor kappa B. Proc Natl Acad Sci U S A. 1989;86:2336–2340.[Abstract/Free Full Text]

23. Das KC, Lewis-Molock Y, White CW. Activation of NF-{kappa}B and elevation of Mn-SOD gene expression by thiol reducing agents in lung adenocarcinoma (A594) cells. Am J Physiol. 1995;269:L588–L602.[Abstract/Free Full Text]

24. Jones PL, Ping D, Boss JM. Tumor necrosis factor alpha and interleukin-1ß regulate the murine manganese superoxide dismutase gene through a complex intronic enhancer involving C/EBP-ß and NF-{kappa}B. Mol Cell Biol. 1997;17:6970–6981.[Abstract]

25. Abate C, Patel L, Rauscher J, et al. Redox regulation of fos and jun DNA-binding activity in vitro. Science. 1990;249:1157–1161.[Abstract/Free Full Text]

26. Menon SD, Qin S, Gu GR, et al. Differential induction of nuclear NF-kB by protein phosphatase inhibitors in primary and transformed human cells: requirement for both oxidation and phosphorylation in nuclear translocation. J Biol Chem. 1993;268:26805–26812.[Abstract/Free Full Text]

27. Hayashi T, Ueno Y, Okamoto T. Oxidoreductive regulation of nuclear factor kB: involvement of a cellular reducing catalyst thioredoxin. J Biol Chem. 1993;268:11380–11388.[Abstract/Free Full Text]

28. Schenk H, Klein M, Erdbrugger W, et al. Distinct effects of thioredoxin and antioxidants on the activation of transcription factor NF-kB and AP-1. Proc Natl Acad Sci U S A. 1994;91:1672–1676.[Abstract/Free Full Text]

29. Pinkus R, Weiner LM, Daniel V. Role of oxidants and antioxidants in the induction of AP-1, NF-kB, and glutathione S-transferase gene expression. J Biol Chem. 1996;271:13422–13429.[Abstract/Free Full Text]

30. Staal FJ, Roederer M, Herzenberg LA, et al. Intracellular thiols regulate activation of nuclear factor kB and transcription of human immunodeficiency virus. Proc Natl Acad Sci U S A. 1990;87:9943–9947.[Abstract/Free Full Text]

31. Hoshida S, Kuzuya T, Fuji H, et al. Sublethal ischemia alters myocardial antioxidant activity in canine heart. Am J Physiol. 1993;264:H33–H39.[Abstract/Free Full Text]

32. Zhou X, Zhai X, Ashraf M. Direct evidence that initial oxidative stress triggered by preconditioning contributes to second window of protection by endogenous antioxidant enzyme in myocytes. Circulation. 1996;93:1177–1184.[Abstract/Free Full Text]

33. Yamashita N, Hoshida S, Nishida M, et al. Heat shock-induced manganese superoxide dismutase enhances the tolerance of cardiac myocytes to hypoxia-reoxygenation injury. J Mol Cell Cardiol. 1997;29:1805–1813.[Medline] [Order article via Infotrieve]

34. Yamashita N, Nishida M, Hoshida S, et al. {alpha}1-Adrenergic stimulation induces tolerance of cardiac myocytes to hypoxia through induction and activation of Mn-SOD. Am J Physiol. 1996;271:H1356–H1362.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
J. Appl. Physiol.Home page
H. J. Zhang, S. R. Doctrow, L. W. Oberley, and K. C. Kregel
Chronic antioxidant enzyme mimetic treatment differentially modulates hyperthermia-induced liver HSP70 expression with aging
J Appl Physiol, April 1, 2006; 100(4): 1385 - 1391.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
Z.-Q. Jin, H.-Z. Zhou, G. Cecchini, M. O. Gray, and J. S. Karliner
MnSOD in mouse heart: acute responses to ischemic preconditioning and ischemia-reperfusion injury
Am J Physiol Heart Circ Physiol, June 1, 2005; 288(6): H2986 - H2994.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
D. A Brown, J. M Lynch, C. J Armstrong, N. M Caruso, L. B Ehlers, M. S Johnson, and R. L Moore
Susceptibility of the heart to ischaemia-reperfusion injury and exercise-induced cardioprotection are sex-dependent in the rat
J. Physiol., April 15, 2005; 564(2): 619 - 630.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
D. A. Brown, K. N. Jew, G. C. Sparagna, T. I. Musch, and R. L. Moore
Exercise training preserves coronary flow and reduces infarct size after ischemia-reperfusion in rat heart
J Appl Physiol, December 1, 2003; 95(6): 2510 - 2518.
[Abstract] [Full Text]


Home page
Cardiovasc ResHome page
M. Joyeux-Faure, C. Arnaud, D. Godin-Ribuot, and C. Ribuot
Heat stress preconditioning and delayed myocardial protection: what is new?
Cardiovasc Res, December 1, 2003; 60(3): 469 - 477.
[Abstract] [Full Text] [PDF]


Home page
J. Thorac. Cardiovasc. Surg.Home page
S. Ghosh and M. Galinanes
Protection of the human heart with ischemic preconditioning during cardiac surgery: role of cardiopulmonary bypass
J. Thorac. Cardiovasc. Surg., July 1, 2003; 126(1): 133 - 142.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
C. Arnaud, M. Joyeux-Faure, D. Godin-Ribuot, and C. Ribuot
COX-2: an in vivo evidence of its participation in heat stress-induced myocardial preconditioning
Cardiovasc Res, June 1, 2003; 58(3): 582 - 588.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
C. Arnaud, D. Godin-Ribuot, S. Bottari, A. Peinnequin, M. Joyeux, P. Demenge, and C. Ribuot
iNOS is a mediator of the heat stress-induced preconditioning against myocardial infarction in vivo in the rat
Cardiovasc Res, April 1, 2003; 58(1): 118 - 125.
[Abstract] [Full Text] [PDF]


Home page
J. Thorac. Cardiovasc. Surg.Home page
J.-Y. Min, Y. Yang, M. F. Sullivan, Q. Ke, K. L. Converso, Y. Chen, J. P. Morgan, and Y.-F. Xiao
Long-term improvement of cardiac function in rats after infarction by transplantation of embryonic stem cells
J. Thorac. Cardiovasc. Surg., February 1, 2003; 125(2): 361 - 369.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
S. Hoshida, N. Yamashita, K. Otsu, and M. Hori
Repeated physiologic stresses provide persistent cardioprotection against ischemia-reperfusion injury in rats
J. Am. Coll. Cardiol., August 21, 2002; 40(4): 826 - 831.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
S. Hoshida, N. Yamashita, K. Otsu, and M. Hori
The importance of manganese superoxide dismutase in delayed preconditioning: Involvement of reactive oxygen species and cytokines
Cardiovasc Res, August 15, 2002; 55(3): 495 - 505.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
R. Bolli
The Late Phase of Preconditioning
Circ. Res., November 24, 2000; 87(11): 972 - 983.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yamashita, N.
Right arrow Articles by Hori, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yamashita, N.
Right arrow Articles by Hori, M.
Related Collections
Right arrow Growth factors/cytokines