| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
(Circulation. 2000;102:452.)
© 2000 American Heart Association, Inc.
Basic Science Reports |
Involvement of Cytokines in the Mechanism of Whole-Body Hyperthermia-Induced Cardioprotection
From the First Department of Medicine (N.Y., S.H., K.O., T.K., M.H.), Department of Pathophysiology (T.K.), and Department of Biochemistry (N.T.), Osaka University Medical School, and the Cardiovascular Division, Osaka Rosai Hospital (S.H.), Osaka, Japan.
Correspondence to Shiro Hoshida, MD, PhD, Cardiovascular Division, Osaka Rosai Hospital, 1179-3 Nagasone-cho, Sakai, Osaka 591-8025, Japan. E-mail hoshidas{at}orh.go.jp
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
Background—Hyperthermia increases cardiac tolerance to ischemia/reperfusion injury and activates manganese superoxide dismutase (Mn-SOD), an intrinsic radical scavenger, in myocardium in a biphasic manner. Tumor necrosis factor-
(TNF-) and interleukin-1ß (IL-1ß)
induced a biphasic cardioprotection that corresponded to the activation
of Mn-SOD. However, a direct association between Mn-SOD activation in
myocardium and the acquisition of tolerance to
ischemia/reperfusion injury induced by hyperthermia and the
involvement of the cytokines in the signal transduction pathway
for the hyperthermia-induced cardioprotection have not yet been
elucidated.
Methods and Results—Hyperthermia was induced in
anesthetized rats by placement in a temperature-controlled
water bath. At 0.5 and 72 hours after hyperthermia, ischemia
was induced by occlusion of the left coronary artery for 20
minutes, followed by reperfusion for 48 hours. Inhibition of the
increases in Mn-SOD content and activity 72 hours after hyperthermia by
the administration of antisense oligodeoxynucleotides to
Mn-SOD abolished the expected decrease in myocardial infarct size. The
simultaneous administration of neutralizing antibodies to
TNF- and IL-1ß before hyperthermia abolished the biphasic
cardioprotection and increase in Mn-SOD activity.
Conclusions—The increase in Mn-SOD activity mediated through the
production of TNF- and IL-1ß by whole-body hyperthermia is
important in the acquisition of early- and late-phase cardioprotection
against ischemia/reperfusion injury in rats.
Key Words: enzymes • hormones • interleukins • hyperthermia • genes
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Cardiac resistance to ischemia/reperfusion injury is increased by exposure to sublethal stress, such as a brief period of ischemia, exercise, or whole-body hyperthermia in a biphasic manner.1 2 3 4 Tolerance after exposure to whole-body hyperthermia is manifested both soon after and 24 to 72 hours after hyperthermia.4 We reported that the time course of manganese superoxide dismutase (Mn-SOD) activation in myocardium corresponded to that of the biphasic cardioprotective effects after hyperthermia, and an increase in the content of Mn-SOD appeared to be responsible for the activation of the enzyme at the late phase.4 Direct proof that the activation and induction of this protein led to the acquisition of tolerance to ischemia/reperfusion injury, however, has not yet been presented.
Tumor necrosis factor- (TNF-) and interleukin-1 (IL-1) are
known as potent inducers of Mn-SOD.5 6 We and others
reported that the administration of TNF- and IL-1ß induced
cardioprotection against ischemia/reperfusion injury 24 to 48
hours after the treatment.3 7 8 9 We also reported that the
time course of the cytokine-induced cardioprotection
exhibited a biphasic pattern similar to that for the activation of
Mn-SOD.3 Moreover, the production of TNF- and
IL-1ß during exercise plays a pivotal role in exercise-induced
cardioprotection through the activation and induction of
Mn-SOD.3 Neta et al10 reported that
radioresistance induced by lipopolysaccharide depended on
induction of TNF and IL-1, because blocking the activities of
these 2 cytokines completely abolished the radioprotective
effect of lipopolysaccharide.
In the present study, we attempted to demonstrate a direct association between the acquisition of tolerance to ischemia/reperfusion injury and Mn-SOD activation in myocardium induced by whole-body hyperthermia, using a rat model of occlusion-reperfusion in the left coronary artery (LCA). We also examined whether the cytokines were involved in the mechanism of hyperthermia-induced cardioprotection.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
This study was carried out under the supervision of the Animal Research Committee in accordance with the Guideline on Animal Experiments of Osaka University and the Japanese Government Animal Protection and Management Law (No. 105).
Animals and Experimental Protocol
Male Wistar rats (300 to 350 g) were maintained on a
12-hour dark/light cycle, housed at 23±1.5°C (45±15% relative
humidity), and allowed access to water and rat chow ad libitum. After
the induction of light anesthesia with sodium pentobarbital
5 to 10 mg/kg IP, whole-body hyperthermia was induced by placing the
rats in a constant-temperature water bath as described
previously.4 11 During whole-body hyperthermia, the animal
was supported by a wire apparatus to prevent the aspiration
of water and to facilitate the measurement of rectal temperature.
Hyperthermia was maintained at 42±0.2°C for 15 minutes (Figure 1
). Rats in the sham-treated control
group were placed in a water bath maintained at
36.5±0.2°C.4 Rats were allowed to recover at room
temperature for defined intervals before the induction of myocardial
infarction. Some rats received neither hyperthermic nor
normothermic water-bath treatment (untreated control).
|
Infarction Protocol
The surgical procedures of occlusion-reperfusion by LCA
occlusion in rats were described previously.4 At the end
of the recovery intervals, rats were anesthetized with sodium
pentobarbital (25 mg/kg IP), intubated, and ventilated with a
small-animal respirator at a rate of 60 to 70 cycles/min and a tidal
volume of 1 mL/100 g body wt. The right femoral artery was cannulated
with polyethylene tubing for the continuous measurement of
arterial blood pressure with a pressure transducer. The
heart rate, incidence of arrhythmias, and ST-segment changes
were monitored. Hemodynamic variables were
recorded continuously. After a 10-minute period of stabilization,
measurement of arterial pressure was initiated and the LCA
was ligated. After 20 minutes of coronary occlusion, the snare
was released. The surgical wounds were repaired 60 minutes after
reperfusion, and the rats were returned to individual cages to recover.
Rats were reanesthetized with sodium pentobarbital (25 mg/kg
IP) 48 hours after reperfusion and were intubated and ventilated with
the respirator. After the heart was exposed and the LCA was reoccluded,
Evans blue dye (2%) was injected via the right femoral vein to
estimate the area perfused by the occluded artery (ischemic
region). Rats were killed by an overdose of sodium pentobarbital. The
left ventricle was then cut into 6 pieces perpendicular to the
apex-base axis. These specimens were incubated with 1%
triphenyltetrazolium chloride at 37°C to
stain the noninfarcted region. The ischemic, infarcted, and
nonischemic areas of tissue were separated with scissors and
weighed.11 12 The area at risk and the infarct size were
defined as the ratios of the mass of the ischemic region to the
left ventricular mass and the mass of the infarct region to
that of the ischemic region, respectively, and were expressed
as percentages. This procedure of infarct size measurement was
performed in a blinded fashion.
Arrhythmias were monitored by ECG. Ventricular fibrillation (VF) was defined according to the criteria of the Lambeth Conventions.13 If VF occurred and did not resolve spontaneously within 3 seconds, manual cardioversion was attempted by gentle flicking of the nonischemic region of the heart. Rats in which VF continued for >6 seconds or cardioversion had to be performed >3 times were excluded from infarct size analysis.
Myocardial Tissue Sampling
To obtain tissue samples for measurements of Mn-SOD content and
activity, rats were killed by an overdose of sodium pentobarbital. The
myocardial tissue was rinsed in PBS, and then blood in the left and
right coronary arteries was washed out with an adequate volume
of PBS from the ascending aorta retrogradely. Both atria and the right
ventricle were removed, and left ventricular myocardial
samples were rapidly frozen by immersion in liquid nitrogen and stored
at -80°C until use.4
Measurement of Activity and Content of Mn-SOD
Myocardial levels of Mn-SOD activity and content were determined
in rats euthanized after recovery intervals of 0.5 and 72 hours after
water-bath treatment and in untreated control rats. Mn-SOD activity of
the myocardial samples was determined by the nitroblue tetrazolium
method.3 4 Mn-SOD content in rats of the untreated
control, sham-treated control, and hyperthermia groups was measured by
an ELISA, as reported previously.3 4 14 The activity and
content of Mn-SOD were expressed relative to the protein concentration
in the supernatant determined by the method of Lowry.
Administration of the Reagents
The phosphorothioated oligodeoxynucleotides were
purchased from Bex. A 22-mer phosphorothioated derivative of antisense
oligodeoxynucleotides (ASODN, CACGCCGCCCGACACAACATTG) to
Mn-SOD, sense oligodeoxynucleotides (SODN,
CAATGTTGTGTCGGGCGGCGTG) to Mn-SOD, or scrambled
oligonucleotide (TCTCAGTGAGAGCCCTCATTCTGT) was injected
just after whole-body hyperthermia at a dose of 10 mg/kg
IP.3 Anti-murine TNF- antibody (0.5 mL IP) and/or
anti-murine IL-1ß antibody (0.5 mg IP) was infused 30 minutes before
whole-body hyperthermia.3 Polyclonal rabbit anti-murine
TNF- antibody and monoclonal hamster anti-murine IL-1ß antibody
were obtained from Genzyme. Both antibodies cross-react with rat
cytokines.15 16
Materials
Chemicals were purchased from Sigma Immunochemicals and Wako
Fine Chemicals.
Statistics
Data are expressed as mean±SEM. The significance of the
differences between groups was assessed by 1-way ANOVA with
Bonferroni’s post hoc test for multiple comparisons. A level of
P<0.05 was considered statistically significant.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Exclusion Because of VF or Death
A total of 6 rats developed serious VF during occlusion (1 in the untreated control group, 2 in the sham-treated control group, 2 in the hyperthermia group treated with ASODN, and 1 in the hyperthermia group pretreated with TNF-
and IL-1ß antibodies) and were excluded from
the evaluation of myocardial infarct size. Six rats died prematurely
(probably because of arrhythmia or heart failure) during the
48-hour reperfusion period (1 in the untreated control group, 2 in the
sham-treated control group, 1 in the hyperthermia group, 1 in the
hyperthermia group treated with ASODN, and 1 in the hyperthermia group
pretreated with TNF- and IL-1ß antibodies).
Hemodynamic Data and Rectal Temperature
No significant differences were observed in the rate-pressure
product or in the rectal temperature during the infarct protocol
among the groups before ischemia, at the end of the
ischemic period, or 0.5 hour after reperfusion (data not
shown).
Direct Relationship Between Cardioprotection and Induction of
Mn-SOD
We examined the relationship between the acquisition of tolerance
to ischemia/reperfusion and the induction of Mn-SOD in the
myocardium 72 hours after whole-body hyperthermia. We
manipulated the level of expression of Mn-SOD using ASODN that
corresponded to the initiation site of Mn-SOD translation. This reagent
was administered intraperitoneally to rats
immediately after whole-body hyperthermia. There were no significant
differences in myocardial Mn-SOD activity and content between the
untreated control group and the sham-treated control group with 72-hour
recovery (Figure 2). As we previously
reported,4 Mn-SOD activity and content in the hyperthermia
group increased at the 72-hour recovery interval (Figures 2 and 5). The administration of ASODN completely inhibited the
increases in Mn-SOD activity and content 72 hours after hyperthermia
(Figure 2). However, SODN or scrambled ODN did not attenuate the
increases in Mn-SOD activity and content induced by hyperthermia
(Figure 2).
|
|
4 rats. *P<0.05
vs sham-treated control rats; #P=NS vs sham-treated
control rats by ANOVA with Bonferroni’s post hoc test for multiple
comparisons.
The size of the area at risk expressed as a percentage of left
ventricular area did not differ significantly among the
groups (Figures 3 and 4). There was no significant difference
in the size of the myocardial infarction between the sham-treated
control group with 72 hours of recovery and the untreated control group
(Figures 3 and 4). The induction of whole-body
hyperthermia reduced the size of myocardial infarction in rats 72 hours
after hyperthermia (Figures 3 and 4), in agreement with
our previous report.4 As shown in Figure 3, the
expected decrease in infarct size was abolished in rats treated with
ASODN to Mn-SOD, in which the induction of Mn-SOD was specifically
inhibited. SODN, which did not attenuate the induction of Mn-SOD in
myocardium after hyperthermia, did not abolish the
protective effect of whole-body hyperthermia. Administration of the
scrambled ODN had no effect on infarct size as seen with SODN.
|
|
Involvement of Cytokines in Hyperthermia-Induced
Cardioprotection
We reported that TNF- and IL-1ß are involved in
exercise-induced cardioprotection.3 To examine whether
these cytokines contribute to the hyperthermia-induced
cardioprotection, we administered neutralizing antibodies to these
cytokines intraperitoneally 30 minutes
before hyperthermia. There were no significant differences in infarct
size among sham-treated control groups (0.5 and 72 hours after
treatment) and the untreated control group (Figure 4
).
Administration of an antibody to TNF- did not influence infarct size
0.5 or 72 hours after hyperthermia (Figure 4). The
administration of an antibody to IL-1ß also did not alter the size of
the myocardial infarct 0.5 or 72 hours after hyperthermia. However,
simultaneous administration of the antibodies to TNF-
and IL-1ß abolished the protection against ischemic damage
0.5 and 72 hours after hyperthermia.
In myocardium from sham-treated control groups, Mn-SOD
activity was unchanged 0.5 and 72 hours after treatment (Figure 5). Mn-SOD activity in the hyperthermia
group increased at the 0.5- and 72-hour recovery intervals compared
with that in the corresponding sham-treated control groups (Figure 5). The activity of the cytosolic isoform of SOD (Cu,Zn-SOD) did
not change after hyperthermia (data not shown). Antibody to TNF- or
IL-1ß had no effect on the increase in Mn-SOD activity induced by
hyperthermia (Figure 5). The simultaneous
administration of the antibodies to these cytokines eliminated
the increase in Mn-SOD activity 0.5 and 72 hours after hyperthermia
(Figure 5) and abolished the increase in Mn-SOD content 72 hours
after hyperthermia (data not shown).
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
We previously reported that exposure to hyperthermia led to a recovery interval–dependent, biphasic reduction in the size of the myocardial infarction as determined after 48 hours of reperfusion. The time course of the increase in myocardial Mn-SOD activity corresponded to that of the cardioprotection, whereas an increase in the content of Mn-SOD corresponded only to the late-phase effect.4 In this study, we found that (1) the expected decrease in infarct size at the early phase induced by hyperthermia was abolished in rats treated with neutralizing antibodies to TNF-
and IL-1ß, in which the
increase in Mn-SOD activity was inhibited; and (2) manipulations
including the administration of ASODN to Mn-SOD and neutralizing
antibodies to TNF- and IL-1ß, which inhibited the induction of
Mn-SOD at the late phase, abolished the delayed protection against
ischemia/reperfusion injury induced by hyperthermia. Taken
together, these results indicated that Mn-SOD plays a central role in
the protective effect of whole-body hyperthermia in both the early and
late phases in rats. A mechanism for the activation of Mn-SOD at the
early phase after hyperthermia, in which there was no difference in
Mn-SOD at the protein level between hyperthermia and sham-treated
control groups, remains to be elucidated.4 The increase in
Mn-SOD activity disappeared by 3 hours after
hyperthermia,4 suggesting that a rapid inactivation should
follow the activation of Mn-SOD. The inhibition of Mn-SOD induction at
the late phase by the administration of ASODN abolished the
hyperthermia-induced cardioprotection. This result indicated that at
the late phase, the induction of Mn-SOD leads to an increase in its
enzyme activity, resulting in the acquisition of cardioprotection
against ischemia/reperfusion injury.
In this study, neutralizing antibodies to TNF- and IL-1ß, which
inhibited the increase in Mn-SOD activity at the early and late phases
and the induction of Mn-SOD at the late phase, abolished the biphasic
cardioprotection against ischemia/reperfusion injury induced by
whole-body hyperthermia. Because there is some redundancy in the
effects of TNF- and IL-1ß,17 18 blocking of TNF-
or IL-1ß by its antibody did not exhibit any effect in our system. We
reported that the administration of TNF- and IL-1ß induces
biphasic cardioprotection and Mn-SOD activation in rats.3
These results suggest that both TNF- and IL-1ß are involved in
hyperthermia-induced cardioprotection via the increase in Mn-SOD
activity. We reported that reactive oxygen species, which are produced
during hyperthermia,19 induce an increase in Mn-SOD
activity, resulting in biphasic hyperthermia-induced
cardioprotection.4 The production of reactive
oxygen species led to increases in TNF- and IL-1ß in
myocardium.3 Therefore, these data indicate
that the production of TNF- and IL-1ß, probably via the
generation of reactive oxygen species during hyperthermia, is important
in the increase in Mn-SOD activity after heat stress.
TNF- and IL-1 cause rapid activation and nuclear
translocation of the transcription factor nuclear factor
(NF)-
B,20 21 22 which strongly correlate with the
induction of Mn-SOD.23 It was recently reported that a
cis-acting TNF-– or IL-1ß–responsive element was
identified for the Mn-SOD gene in mouse, and NF-B binds to the
element.24 The transcription factor NF-B is
subject to redox regulation.25 26 27 28 29 30 NF-B might play a
role in the cytokine-mediated Mn-SOD induction at the late
phase. A mechanism of Mn-SOD activation by TNF- and IL-1ß at the
early phase, however, remains to be elucidated.
We reported that exercise induced a biphasic cardioprotection with the
activation of Mn-SOD.3 Combined administration of the
antibodies to TNF- and IL-1ß abolished the biphasic
cardioprotection induced by exercise.3 We also reported
that reactive oxygen species produced during exercise are involved in
the production of TNF- and IL-1ß and the biphasic
activation of Mn-SOD.3 Brief sublethal ischemic or
anoxic insults also have been shown to increase Mn-SOD activity and to
induce cardioprotection or myocyte protection in a biphasic
manner.31 32 Mn-SOD is directly associated with the
delayed protection of the myocyte against
hypoxia-reoxygenation injury in an in vitro
model.14 33 34 The acquisition of cardioprotection by
sublethal stress, such as whole-body hyperthermia, exercise, or
ischemia, may involve a common mechanism that functions through
an induction and activation of Mn-SOD via the production of
reactive oxygen species and cytokines.
Conclusions
Whole-body hyperthermia induced a biphasic increase in Mn-SOD
activity and biphasic cardioprotection in rats. The administration of
ASODN to Mn-SOD, which inhibited the induction of Mn-SOD at the late
phase, abolished hyperthermia-induced delayed cardioprotection against
ischemia/reperfusion injury. The neutralizing antibodies to
TNF- and IL-1ß, in which the increase in Mn-SOD activity was
inhibited, abolished the expected decrease in infarct size induced by
hyperthermia. These results suggest that TNF- and IL-1ß are
involved in hyperthermia-induced cardioprotection via the activation
and induction of Mn-SOD.
|
Acknowledgments |
|---|
This work was supported in part by research grants from the Ministry of Education, Science, and Culture of Japan (Drs Hoshida and Hori). We thank Dr Kei-ichiro Suzuki for providing polyclonal antibody to rat Mn-SOD.
Received September 29, 1999; revision received February 7, 2000; accepted February 29, 2000.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
-
Kuzuya T, Hoshida S, Yamashita N, et
al. Delayed effects of sublethal ischemia on the acquisition of
tolerance to ischemia. Circ Res. 1993;72:1293–1299.
[Abstract/Free Full Text]
-
Marber MS, Latchman DS, Walker JM, et al. Cardiac
stress protein elevation 24 hours after brief ischemia or heat
stress is associated with resistance to myocardial infarction.
Circulation. 1993;88:1264–1272.
[Abstract/Free Full Text]
-
Yamashita N, Hoshida S, Otsu K, et al. Exercise
provides direct biphasic cardioprotection via manganese superoxide
dismutase activation. J Exp Med. 1999;189:1699–1706.
[Abstract/Free Full Text]
-
Yamashita N, Hoshida S, Taniguchi N, et al. Whole-body
hyperthermia provides biphasic cardioprotection against
ischemia/reperfusion injury in the rat. Circulation. 1998;98:1414–1421.
[Abstract/Free Full Text]
-
Wong GHW, Goeddel DV. Induction of manganese
superoxide dismutase by tumor necrosis factor: possible protective
mechanism. Science. 1988;242:941–944.
[Abstract/Free Full Text]
-
Masuda A, Longo DL, Kobayashi Y, et al. Induction of
mitochondrial manganese superoxide dismutase by interleukin 1.
FASEB J. 1988;2:3087–3091.[Abstract]
-
Brown JM, White CW, Terada LS, et al. Interleukin 1
pretreatment decreases ischemia/reperfusion injury. Proc
Natl Acad Sci U S A. 1990;87:5026–5030.
[Abstract/Free Full Text]
-
Eddy LJ, Goeddel DV, Wong GHW. Tumor necrosis
factor- pretreatment is protective in a rat model of myocardial
ischemia-reperfusion injury. Biochem Biophys Res
Commun. 1992;184:1056–1059.[Medline]
[Order article via Infotrieve]
-
Nelson SK, Wong GHW, McCord JM. Leukemia
inhibitory factor and tumor necrosis factor induce
manganese superoxide dismutase and protect rabbit hearts from
reperfusion injury. J Mol Cell Cardiol. 1995;27:223–229.[Medline]
[Order article via Infotrieve]
-
Neta R, Oppenheim JJ, Schreiber RD, et al. Role of
cytokines (interleukin 1, tumor necrosis factor, and
transforming growth factor ß) in natural and
lipopolysaccharide-enhanced radioresistance. J Exp
Med. 1991;173:1177–1182.
[Abstract/Free Full Text]
-
Yamashita N, Hoshida S, Nishida M, et al. Time course
of tolerance to ischemia-reperfusion injury and induction of
heat shock protein 72 by heat stress in the rat heart. J Mol Cell
Cardiol. 1997;29:1815–1821.[Medline]
[Order article via Infotrieve]
-
Yamashita N, Hoshida S, Taniguchi N, et al. A "second
window of protection" occurs 24 h after ischemic
preconditioning in the rat heart. J Mol Cell Cardiol. 1998;30:1181–1189.[Medline]
[Order article via Infotrieve]
-
Walker MJ, Curtis MJ, Hearse DJ, et al. The Lambeth
Conventions: guidelines for the study of arrhythmias in
ischaemia, infarction, and reperfusion. Cardiovasc Res. 1988;22:447–455.[Medline]
[Order article via Infotrieve]
-
Yamashita N, Nishida M, Hoshida S, et al. Induction of
manganese superoxide dismutase in rat cardiac myocytes increases
tolerance to hypoxia 24 hours after preconditioning.
J Clin Invest. 1994;94:2193–2199.
-
Teti G, Mancuso G, Tomasello F. Cytokine
appearance and effects of anti-tumor necrosis factor alpha antibodies
in a neonatal rat model of group B streptococcal infection.
Infect Immun. 1993;61:227–235.
[Abstract/Free Full Text]
-
Wu X, Witter AJ, Carr LS, et al.
Cytokine-induced neutrophil chemoattractant mediates
neutrophil influx in immune complex glomerulonephritis in rat.
J Clin Invest. 1994;94:337–344.
-
Aggarwal BB, Natarajan K. Tumor necrosis factor:
developments during the last decade. Eur Cytokine
Netw. 1996;7:93–124.[Medline]
[Order article via Infotrieve]
-
Dinarello CA. Interleukin-1 and its biologically
related cytokines. Adv Immunol. 1989;44:153.[Medline]
[Order article via Infotrieve]
-
Salo DC, Donovan CM, Davies KJA. HSP70 and other
possible heat shock or oxidative stress proteins are induced in
skeletal muscle, heart, and liver during exercise. Free Radic
Biol Med. 1991;11:239–246.[Medline]
[Order article via Infotrieve]
-
Beg AA, Baldwin AS. Activation of multiple
NF-B/Rel DNA-binding complexes by tumor necrosis factor.
Oncogene. 1994;9:1487–1492.[Medline]
[Order article via Infotrieve]
-
Beg AA, Finco TS, Nantermet PV, et al. Tumor necrosis
factor and interleukin-1 lead to phosphorylation and
loss of IB: a mechanism for NF-B activation. Mol
Cell Biol. 1993;13:3301–3310.
[Abstract/Free Full Text]
-
Osborn L, Kunkel S, Nabel GJ. Tumor necrosis factor
alpha and interleukin 1 stimulate the human immunodeficiency virus
enhancer by activation of the nuclear factor kappa B. Proc Natl
Acad Sci U S A. 1989;86:2336–2340.
[Abstract/Free Full Text]
-
Das KC, Lewis-Molock Y, White CW. Activation of
NF-B and elevation of Mn-SOD gene expression by thiol reducing
agents in lung adenocarcinoma (A594) cells. Am J
Physiol. 1995;269:L588–L602.
[Abstract/Free Full Text]
-
Jones PL, Ping D, Boss JM. Tumor necrosis factor alpha
and interleukin-1ß regulate the murine manganese superoxide
dismutase gene through a complex intronic enhancer involving C/EBP-ß
and NF-B. Mol Cell Biol. 1997;17:6970–6981.[Abstract]
-
Abate C, Patel L, Rauscher J, et al. Redox regulation
of fos and jun DNA-binding activity in vitro. Science. 1990;249:1157–1161.
[Abstract/Free Full Text]
-
Menon SD, Qin S, Gu GR, et al. Differential induction
of nuclear NF-kB by protein phosphatase inhibitors in
primary and transformed human cells: requirement for both oxidation and
phosphorylation in nuclear translocation. J
Biol Chem. 1993;268:26805–26812.
[Abstract/Free Full Text]
-
Hayashi T, Ueno Y, Okamoto T. Oxidoreductive regulation
of nuclear factor kB: involvement of a cellular reducing catalyst
thioredoxin. J Biol Chem. 1993;268:11380–11388.
[Abstract/Free Full Text]
-
Schenk H, Klein M, Erdbrugger W, et al. Distinct
effects of thioredoxin and antioxidants on the activation of
transcription factor NF-kB and AP-1. Proc Natl Acad Sci
U S A. 1994;91:1672–1676.
[Abstract/Free Full Text]
-
Pinkus R, Weiner LM, Daniel V. Role of oxidants and
antioxidants in the induction of AP-1, NF-kB, and glutathione
S-transferase gene expression. J Biol Chem. 1996;271:13422–13429.
[Abstract/Free Full Text]
-
Staal FJ, Roederer M, Herzenberg LA, et al.
Intracellular thiols regulate activation of nuclear factor kB and
transcription of human immunodeficiency virus. Proc Natl Acad Sci
U S A. 1990;87:9943–9947.
[Abstract/Free Full Text]
-
Hoshida S, Kuzuya T, Fuji H, et al. Sublethal
ischemia alters myocardial antioxidant activity in canine
heart. Am J Physiol. 1993;264:H33–H39.
[Abstract/Free Full Text]
-
Zhou X, Zhai X, Ashraf M. Direct evidence that initial
oxidative stress triggered by preconditioning contributes to second
window of protection by endogenous antioxidant enzyme in
myocytes. Circulation. 1996;93:1177–1184.
[Abstract/Free Full Text]
-
Yamashita N, Hoshida S, Nishida M, et al. Heat
shock-induced manganese superoxide dismutase enhances the tolerance of
cardiac myocytes to hypoxia-reoxygenation
injury. J Mol Cell Cardiol. 1997;29:1805–1813.[Medline]
[Order article via Infotrieve]
-
Yamashita N, Nishida M, Hoshida S, et al.
1-Adrenergic stimulation induces tolerance of cardiac myocytes to
hypoxia through induction and activation of Mn-SOD.
Am J Physiol. 1996;271:H1356–H1362.
[Abstract/Free Full Text]
This article has been cited by other articles:
 |
|
 |
|
  H. J. Zhang, S. R. Doctrow, L. W. Oberley, and K. C. Kregel Chronic antioxidant enzyme mimetic treatment differentially modulates hyperthermia-induced liver HSP70 expression with aging J Appl Physiol, April 1, 2006; 100(4): 1385 - 1391. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z.-Q. Jin, H.-Z. Zhou, G. Cecchini, M. O. Gray, and J. S. Karliner MnSOD in mouse heart: acute responses to ischemic preconditioning and ischemia-reperfusion injury Am J Physiol Heart Circ Physiol, June 1, 2005; 288(6): H2986 - H2994. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. A Brown, J. M Lynch, C. J Armstrong, N. M Caruso, L. B Ehlers, M. S Johnson, and R. L Moore Susceptibility of the heart to ischaemia-reperfusion injury and exercise-induced cardioprotection are sex-dependent in the rat J. Physiol., April 15, 2005; 564(2): 619 - 630. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. A. Brown, K. N. Jew, G. C. Sparagna, T. I. Musch, and R. L. Moore Exercise training preserves coronary flow and reduces infarct size after ischemia-reperfusion in rat heart J Appl Physiol, December 1, 2003; 95(6): 2510 - 2518. [Abstract] [Full Text]
|
|
|
|
 |
|
 M. Joyeux-Faure, C. Arnaud, D. Godin-Ribuot, and C. Ribuot Heat stress preconditioning and delayed myocardial protection: what is new? Cardiovasc Res, December 1, 2003; 60(3): 469 - 477. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Ghosh and M. Galinanes Protection of the human heart with ischemic preconditioning during cardiac surgery: role of cardiopulmonary bypass J. Thorac. Cardiovasc. Surg., July 1, 2003; 126(1): 133 - 142. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Arnaud, M. Joyeux-Faure, D. Godin-Ribuot, and C. Ribuot COX-2: an in vivo evidence of its participation in heat stress-induced myocardial preconditioning Cardiovasc Res, June 1, 2003; 58(3): 582 - 588. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Arnaud, D. Godin-Ribuot, S. Bottari, A. Peinnequin, M. Joyeux, P. Demenge, and C. Ribuot iNOS is a mediator of the heat stress-induced preconditioning against myocardial infarction in vivo in the rat Cardiovasc Res, April 1, 2003; 58(1): 118 - 125. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.-Y. Min, Y. Yang, M. F. Sullivan, Q. Ke, K. L. Converso, Y. Chen, J. P. Morgan, and Y.-F. Xiao Long-term improvement of cardiac function in rats after infarction by transplantation of embryonic stem cells J. Thorac. Cardiovasc. Surg., February 1, 2003; 125(2): 361 - 369. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Hoshida, N. Yamashita, K. Otsu, and M. Hori Repeated physiologic stresses provide persistent cardioprotection against ischemia-reperfusion injury in rats J. Am. Coll. Cardiol., August 21, 2002; 40(4): 826 - 831. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Hoshida, N. Yamashita, K. Otsu, and M. Hori The importance of manganese superoxide dismutase in delayed preconditioning: Involvement of reactive oxygen species and cytokines Cardiovasc Res, August 15, 2002; 55(3): 495 - 505. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Bolli The Late Phase of Preconditioning Circ. Res., November 24, 2000; 87(11): 972 - 983. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||