This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Giglio, S. Articles by Zuffardi, O. Search for Related Content PubMed PubMed Citation Articles by Giglio, S. Articles by Zuffardi, O. Related Collections Clinical genetics Cardiac development Genetics of cardiovascular disease

(Circulation. 2000;102:432.)
© 2000 American Heart Association, Inc.

Clinical Investigation and Reports

Deletion of a 5-cM Region at Chromosome 8p23 Is Associated With a Spectrum of Congenital Heart Defects

Sabrina Giglio, MD; Sharon L. Graw, PhD; Giorgio Gimelli, PhD; Barbara Pirola, PhD; Paolo Varone, PhD; Lucille Voullaire, MSc; Franco Lerzo, MD; Elena Rossi, PhD; Claudia Dellavecchia, PhD; Maria Clara Bonaglia, PhD; Maria Cristina Digilio, MD; Aldo Giannotti, MD; Bruno Marino, MD; Romeo Carrozzo, MD; Julie R. Korenberg, MD; Cesare Danesino, MD; Eva Sujansky, MD; Bruno Dallapiccola, MD; Orsetta Zuffardi, PhD

From the Biologia Generale e Genetica Medica, Università di Pavia, Pavia, Italy (S.G., B.P., E.R., C. Dellavecchia, C. Danesino, O.Z.); the Eleanor Roosevelt Institute, Denver, Co (S.L.G.); the Laboratorio di Citogenetica and Divisione di Cardiochirurgia, Istituto G. Gaslini, Genova, Italy (G.G., P.V., F.L.); the Murdoch Institute, Royal Children’s Hospital, Parkville, Australia (L.V.); the Istituto Scientifico E. Medea, Bosisio Parini, Lecco, Italy (M.C.B); the Genetica Medica e Cardiologia, Ospedale Bambin Gesù, Rome, Italy (M.C.D., A.G., B.M.); Medical Genetics Division, Department of Pediatrics, Cedars-Sinai Medical Center, Los Angeles, Calif (J.R.K.); University of Colorado Health Sciences Center, Denver, Co (E.S.); the University La Sapienza and Istituto CSS-Mendel, Rome, Italy (B.D); and the Ospedale San Raffaele, Milan, Italy (R.C., O.Z.).

	Abstract

Top Abstract Introduction Methods Results Discussion References

 
Background—Cytogenetic evidence suggests that the haploinsufficiency of 1 gene located in 8p23 behaves as a dominant mutation, impairing heart differentiation and leading to a wide spectrum of congenital heart defects (CHDs), including conotruncal lesions, atrial septal defects, atrioventricular canal defects, and pulmonary valve stenosis. An 8p heart-defect–critical region was delineated, and the zinc finger transcription factor GATA4 was considered a likely candidate for these defects. We narrowed this region and excluded a major role of GATA4 in these CHDs.

Methods and Results—We studied 12 patients (7 had CHD and 5 did not) with distal 8p deletions from 9 families by defining their chromosome rearrangements at the molecular level by fluorescent in situ hybridization and short-tandem repeat analysis. Subjects with 8p deletions distal to D8S1706, at 10 cM from the 8p telomere, did not have CHD, whereas subjects with a deletion that included the more proximal region suffered from the spectrum of heart defects reported in patients with 8p distal deletions. The 5-cM critical region is flanked distally by D8S1706 and WI-8327, both at 10 cM, and proximally by D8S1825, at 15 cM. Neither GATA4 nor angiopoietin-2 (ANGPT2; a gene in 8p23 involved in blood vessel formation) were found to be deleted in some of the critical patients. We also found that CHDs are not related to the parental origin of deletion.

Conclusions—Haploinsufficiency for a gene between WI-8327 and D8S1825 is critical for heart development. A causal relationship does not seem to exist between GATA4 and ANGPT2 haploinsufficiency and CHDs.

Key Words: heart defects, congenital • chromosomes, 8 • gene deletion • GATA4 • ANGPT2

	Introduction

Top Abstract Introduction Methods Results Discussion References

 
Genetic susceptibility to congenital heart defects (CHDs) has been considered a component of multifactorial inheritance, although Mendelian inheritance has been established for some of these defects.^{1 2} A major contribution to the location of CHD genes has been provided by chromosome abnormalities. The TBX5 gene, which is related to Holt Oram syndrome, was cloned after fine analysis of a de novo translocation that disrupted the critical region at 12q24 in one patient.³ A causal relationship between the mutation and deletion of the elastin gene and supravalvular aortic stenosis was established by sequencing the breakpoint at 7q11.23 in a family with a 6p;7q reciprocal translocation.⁴ Conotruncal heart defects in DiGeorge and velocardiofacial syndrome patients are usually due to the haploinsufficiency of genes located at 22q11.2.⁵

A wide spectrum of heart defects, including conotruncal anomalies, ventricular or atrial septal defects, pulmonary valve stenosis, patent ductus arteriosus, and persistent left superior vena cava, have been reported in patients with distal 8p deletions.^{6 7 8 9 10 11 12 13 14} It is unclear at present if a single gene or several genes in this region have a role in heart differentiation. Devriendt et al¹⁴ defined an 8p heart-defect–critical region spanning a 10-cM segment defined distally by D8S1706 and proximally by D8S1759, and they suggested the transcription factor GATA4 as a candidate gene. We narrowed this region by studying 12 del(8p) patients, including 6 new cases, 7 of whom had CHDs. We also excluded a major role of GATA4 and angiopoietin-2 (ANGPT2) in these CHDs.

	Methods

Top Abstract Introduction Methods Results Discussion References

 
Patients
Patient karyotypes, cardiac findings, and other clinical manifestations are summarized in Table 1. All the patients underwent cardiac examination by 2D and color Doppler echocardiography and by cardiac catheterization. All cases, except patients 1 and 2 in whom the chromosome abnormality was found at amniocentesis, were determined because of mental retardation and facial dysmorphisms and malformations.

View this table: [in this window] [in a new window]   Table 1. Patient Karyotypes and Clinical Findings

Cytogenetics and Molecular Analysis
Lymphoblastoid cell lines were prepared from all patients after informed consent was obtained from them or their parents. Conventional cytogenetic and fluorescent in situ hybridization (FISH) analyses were performed on lymphocyte chromosome preparations from all patients. Yeast artificial chromosomes (YACs) spread in 8p from the CEPH human Mega-YAC library were obtained from Italian Genome Resources (IGeR). Subtelomeric sequences for chromosome 16q (Oncor Appligene) were used to investigate the reciprocity of the translocation t(8;16) in the father of case 10. FISH with P1 artificial chromosomes (PACs) containing GATA4 and ANGPT2 was performed to assess the involvement of these factors in the deleted critical region.

Short-tandem repeat polymorphisms (STRPs) at 8p loci were examined in patients 1, 3, 4, 7, 9, 11, and 12 and in some of their parents using routine methods with primers purchased from Research Genetics.

Screening of the human genomic PAC libraries (Genome Systems) was performed to obtain PACs related to GATA4 and ANGPT2. Primers for GATA4 were forward CCCCTCTTCCCTCCTCAAAT and reverse TTCCCCTGGCCGGGTTGTCG (D78260 GenBank accession number); for ANGPT2, they were forward CCCAGTCCACCTGAGGAACT and reverse TGCTTTGGTCCGTTAAGTGATG (AF004327 GenBank accession number). These primers were from cDNA sequences given in the 5' to 3' direction.

	Results

Top Abstract Introduction Methods Results Discussion References

 
Results of the FISH and STRP analyses are summarized in Table 2, and the results of the parental origin of the abnormal chromosomes are shown in Table 3.

View this table: [in this window] [in a new window]   Table 2. FISH and STRP Results: Locus Copy Number on the Abnormal Chromosome 8

View this table: [in this window] [in a new window]   Table 3. Parental Origin of the Abnormal Chromosomes 8

Cases 1 and 2 showed the most distal deletions, covering <9 cM from D8S277 to the telomere (Figure 1a). The parents of case 1 had normal karyotypes. The absence of paternal alleles at informative loci (Figure 2a) indicated that the deletion was inherited from the father. Deletions in cases 3 through 5, which were previously defined as pter-D8S277,¹⁵ were refined by FISH as pter-D8S1819, an interval of 10 cM from the 8p telomere (Figure 1b). These rearrangements are maternal in origin.¹⁵

View larger version (34K): [in this window] [in a new window]   Figure 1. FISH experiments. a, Case 1. FISH with YACs 787C11 (D8S201: 8p23.3) and pJM128 (D8Z2: centromere) shows the absence of 8p signal in del(8) (arrowhead). Arrow shows normal chromosome 8. b, Case 5. FISH with 963E6 (D8S1819: 10 cM from 8p telomere; red signal) and 795A5 (D8S1706: 10.5 cM; green signal) shows overlapping of red and green signals in normal chromosome 8 (arrow) and only the green signal in the invdup(8p) (arrowhead). c, Father of case 6. FISH with 792A6 (WI-8327: 10.5 cM; green signal) and pJM128 (D8Z2: centromere, red signal) shows green signals in normal chromosome 8 (arrow) and in der(1) (thin arrow), thus demonstrating that the patient, who inherited der(8), is deleted at least up to WI-8327. Large arrowhead indicates der(8); small arrowhead, normal chromosome 1. d, Father of case 6. FISH with 871A8 (D8S1825: 15 cM) shows signals in the normal (arrow) and in the der(8) chromosome (arrowhead). e, Case 7. FISH with 792A6 (WI-8327: 10.5 cM; green signal) and 871A8 (D8S1825: 15 cM; red signal) shows overlapping of red and green signals in normal chromosome 8 (arrow) and only the red signal in rec(8) (arrowhead). f, Case 8. FISH with 2 YACs flanking deletions at 792A6 (WI-8327: 10.5 cM; green signal) and 894G9 (D8S1130: 21 cM; red signal). The signals overlap in del(8) (arrowhead); they are well separated in normal chromosome 8 (arrow). g, Father of case 10. FISH with 920D12 (D8S552: 26 cM) shows signals in normal chromosome 8 (thick arrow), in der(8) (large arrowhead), and in der(16) (thin arrow), thus demonstrating that this YAC spans the breakpoint. Small arrowhead indicates normal chromosome 16.

View larger version (127K): [in this window] [in a new window]   Figure 2. DNA analysis of cases 1 (left), 11 (middle), and 12 (right) and their parents by polymerase chain reaction. Only the maternal allele is present in cases 1 and 12, whereas the paternal one is present in case 11. Thus, the origin of the deletion is paternal in cases 1 and 12 and maternal in case 11.

In case 6, FISH analysis defined the 8p breakpoint to a 5-cM region between WI-8327 and D8S1825. The patient’s father had a reciprocal translocation t(8;16) (Figures 1c and 1d). Case 7 was a recombinant 8 patient of Hispanic origin.⁹ FISH analysis in the proposita assigned the 8p breakpoint to between WI-8327 and D8S1825 (Figure 1e); the deletion spanned an interval of 15 cM. FISH analysis in case 8, which was previously reported as 46,XY, del(8)(p23),⁸ disclosed a 11-cM interstitial deletion from WI-8327 to D8S1130 (Figure 1f). The patient’s parents had normal karyotypes.

Chromosome and FISH analysis in the parents of case 10 revealed a paternal translocation of t(8;16)(p23.1;q24). YAC 920-D-12 (CHLC.GATA25C10-D8S552) spanned the derivative chromosome 8 breakpoint (Figure 1g), and the subtelomeric 16q specific sequences were found on der(8) (data not shown). Thus, the rearranged chromosome 8 in cases 9 and 10 was interpreted as der(8), t(8;16) (p23.1;q24). The deletion spanned an interval of 26 cM, from D8S552 to 8pter. STRP analyses in cases 11 and 12 and their parents showed that the deletions were larger compared with those in other patients and that they were, respectively, maternal and paternal in origin (Figures 2b and 2c).

In summary, the deletions clustered within an 8- to 10-cM segment at distal 8p in cases 1 through 5, who did not have CHDs. The deletions were more proximally located in cases 6 to 12, who had CHDs. The smallest region of deletion overlap associated with a CHD was between WI-8327, the most proximal sequence-tagged site of contig WC8.0, and D8S1825, the most distal sequence-tagged site of contig WC8.1. In addition, FISH analysis with 2 GATA4 PACs revealed signals in the abnormal chromosome 8 in cases 6 and 7 and an absence in the deleted chromosome 8 in case 8 (Figure 3); FISH with one ANGPT2 PAC revealed signals in the abnormal chromosome 8 in case 8 but not in cases 6 and 7 (data not shown). These observations assign GATA4 as proximal to D8S1825 and distal to D8S1130 and ANGPT2, which was previously located between WI-3823 and CHCL.GCT18CO2,¹⁶ distal to D8S1825.

View larger version (24K): [in this window] [in a new window]   Figure 3. FISH analysis of cases 6 (a), 7 (b), and 8 (c) with PAC 1058I6 (GATA4) shows signals in both the normal (arrows) and the abnormal chromosome 8 (arrowheads) in cases 6 and 7 and in only the normal chromosome 8 in case 8. The same hybridization pattern was obtained with PAC 1061I23.

	Discussion

Top Abstract Introduction Methods Results Discussion References

 
The present results define a 5-cM critical region at 8p23, between WI-8327 and D8S1825, in which 1 genes critical for heart differentiation are likely to be located. We found that all subjects with a deletion within this region (cases 6 to 12) had CHDs, whereas those with more distal deletions spanning from D8S1819 to the telomere (cases 1 to 5), did not. In case 6, the deletion is concurrent with trisomy 1q42-qter, which is an inconsistent cause of CHDs.¹⁷ Because the breakpoint at 8p was disrupting the 8p heart-defect–critical region, a relationship of pulmonary stenosis with the rearrangement at 8p is more likely than the duplication of 1q. In cases 9 and 10, the 8p deletion was concurrent with a duplication of 16q24, which per se does not associate with CHDs.¹⁸ Thus, in these cases, CHDs are likely due to del 8p.

A consistent involvement of laterality defects was suggested in patients with distal del8p and CHDs; this was based on the nonrandom occurrence of atrioventricular canal defects, abnormalities of the pulmonary and systemic vein returns, pulmonary stenosis, single ventricle, transposition of the great arteries, and dextrocardia.¹³ Additional CHDs associated with del 8p include atrial septal defects, patent ductus arteriosus, truncus arteriosus, double-outlet right ventricle, tetralogy of Fallot, and mitral atresia/stenosis.^{12 13 14} A similar wide spectrum of different CHDs also occurs in patients with recombinant 8 syndrome.^{9 19} Our case 7 is a member of this extended family. These observations either suggest that a cluster of genes affecting heart differentiation is located on the distal chromosome 8p and the haploinsufficiency of each of them results in distinct CHDs or that a single gene in this region is critical for cardiac morphogenesis. Molecular investigations of 8p deletion in our cases 6 through 8 have narrowed the critical region to the 5-cM interval between D8S1825 and WI-8327.

An 8p heart-defect–critical region has been assigned to a 10-cM interval between D8S1706 and D8S1759.¹⁴ Because GATA4 affects the initial steps of cardiac morphogenesis²⁰ and was deleted in 5 patients with del 8p and CHDs and was present in one patient without CHDs, Devriendt et al¹⁴ considered this gene a candidate for heart defects associated with distal 8p deletions. Additional observations in other patients have supported a causal relationship between GATA4 haploinsufficiency and CHDs.²¹ The present results showed that GATA4 was deleted in case 8 but not in cases 6 and 7. These observations do not support a causal relationship between a deficiency of this gene product and 8p-CHD. Similarly, it is unlikely that ANGPT2, a member of the vascular endothelial growth factor localized to 8p23,¹⁶ is involved in these CHDs because it was not deleted in case 8. However, an impaired expression of these genes by a positional effect cannot be excluded. The present results also exclude any imprinting effect in CHDs associated with del 8p, which occur both in patients with paternally (cases 6, 7, 10, and 11) and maternally inherited (cases 9 and 12) deletions.

	Acknowledgments

 
Part of the cell lines have been stored thanks to Telethon project C.18. Drs Zuffardi and Giglio were supported by cofin98-MURST (Ministero Università Ricerca Scientifica Tecnologica) and by the Istituto di Ricerca e Cura a Carattere Scientifico Policlinico San Matteo, Pavia. Dr Graw was supported by the Dorothea Haus Ross Foundation and the American Heart Association of Colorado/Wyoming (CWGS-32-98).

	Footnotes

 
Correpondence to O. Zuffardi, Biologia Generale e Genetica Medica, Via Forlanini 14, PO Box CP 217, 27100 Pavia, Italy.

Received December 31, 1999; revision received February 14, 2000; accepted February 28, 2000.

	References

Top Abstract Introduction Methods Results Discussion References

 
1. Belmont JW. Recent progress in the molecular genetics of congenital heart defects. Clin Genet. 1998;54:11–19.[Medline] [Order article via Infotrieve]

2. Burn J, Brennan P, Little J, et al. Recurrence risks in offspring of adults with major heart defects: results from first cohort of British collaborative study. Lancet. 1998;351:311–316.[Medline] [Order article via Infotrieve]

3. Li QY, Newbury-Ecob RA, Terrett JA, et al. Holt-Oram syndrome is caused by mutations in TBX5, a member of the Brachyury (T) gene family. Nat Genet. 1997;15:21–29.[Medline] [Order article via Infotrieve]

4. Curran ME, Atkinson DL, Ewart AK, et al. The elastin gene is disrupted by a translocation associated with supravalvular aortic stenosis. Cell. 1993;73:159–168.[Medline] [Order article via Infotrieve]

5. Linday EA, Botta A, Jurecic V, et al. Congenital heart disease in mice deficient for the diGeorge syndrome region. Nature. 1999;401:379–383.[Medline] [Order article via Infotrieve]

6. Marino B, Reale A, Giannotti A, et al. Nonrandom association of atrioventricular canal and del (8p) syndrome. Am J Med Genet. 1992;42:424–427.

7. Digilio MC, Giannotti A, Marino B, et al. Atrioventricular canal and 8p-syndrome. Am J Med Genet. 1993;47:437–438.

8. Hutchinson R, Wilson M, Voullaire L. Distal 8p deletion (8p23.1–8pter): a common deletion? J Med Genet. 1992;29:407–411.[Abstract/Free Full Text]

9. Sujanski E, Smith ACM, Prescott KE, et al. Natural history of the "recombinant 8" syndrome. Am J Med Genet. 1993;47:512–525.[Medline] [Order article via Infotrieve]

10. Wu BL, Schneider GH, Sabatino DE, et al. Distal 8p deletion (8)(p23): an easily missed chromosome abnormality that may be associated with congenital heart defect and mental retardation. Am J Med Genet. 1996;62:77–83.[Medline] [Order article via Infotrieve]

11. Claeys I, Holvoet M, Eyskens B, et al. A recognisable behavioral phenotype associated with terminal deletions of the short arm of chromosome 8. Am J Hum Genet. 1997;74:515–520.

12. Johnson MC, Hing A, Wood MK, et al. Chromosome abnormalities in congenital heart disease. Am J Med Genet. 1997;70:292–298.[Medline] [Order article via Infotrieve]

13. Digilio MC, Marino B, Guccione P, et al. Deletion 8p syndrome. Am J Med Genet. 1998;75:534–536.[Medline] [Order article via Infotrieve]

14. Devriendt K, Matthijs G, Van Dael R, et al. Delineation of the critical deletion region for congenital heart defects on chromosome 8p23.1. Am J Hum Genet. 1999;64:1119–1126.[Medline] [Order article via Infotrieve]

15. Floridia G, Piantanida M, Minelli A, et al. The same molecular mechanism, in the maternal meiosis I, produces mono- and dicentric 8p duplications. Am J Hum Genet. 1996;58:785–796.[Medline] [Order article via Infotrieve]

16. Cheung AH, Stewart RJ, Marsden PA. Endothelial Tie2/Tek ligands angiopoietin-1 (ANGPT1) and angiopoietin-2 (ANGPT2): regional localization of the human genes to 8q22.3 and 8p23. Genomics. 1998;98:389–391.

17. Johnson VP. Duplication of the distal part of the long arm of chromosome 1. Am J Med Genet. 1991;39:258–269.[Medline] [Order article via Infotrieve]

18. Houlston RS, Renshaw RM, James RS, et al. Duplication 16q22-qter confirmed by fluorescence in situ hybridisation and molecular analysis. J Med Genet. 1994;31:884–887.[Abstract/Free Full Text]

19. Gelb BD, Towbin JA, McCabe ERB, et al. San Luis Valley recombinant chromosome 8 and tetralogy of Fallot: a review of chromosome 8 anomalies and congenital heart disease. Am J Med Genet. 1991;40:471–476.[Medline] [Order article via Infotrieve]

20. Grepin C, Robitaille L, Antakly T, et al. Inhibition of transcription factor GATA4 expression blocks in vitro cardiac muscle differentiation. Mol Cell Biol. 1 1995;5:4095–4102.

21. Pehlivan T, Pober BR, Brueckner M, et al. GATA4 haploinsufficiency in patients with interstitial deletion of chromosome region 8p23.1 and congenital heart disease. Am J Med Genet. 1999;83:201–206.[Medline] [Order article via Infotrieve]

This article has been cited by other articles:

				C. Saffirio, B. Marino, and M. C. Digilio GATA4 as Candidate Gene for Pericardial Defects Ann. Thorac. Surg., December 1, 2007; 84(6): 2137 - 2137. [Full Text] [PDF]

				A Tomita-Mitchell, C L Maslen, C D Morris, V Garg, and E Goldmuntz GATA4 sequence variants in patients with congenital heart disease J. Med. Genet., December 1, 2007; 44(12): 779 - 783. [Abstract] [Full Text] [PDF]

				N. Bosch, M. Caceres, M. F. Cardone, A. Carreras, E. Ballana, M. Rocchi, L. Armengol, and X. Estivill Characterization and evolution of the novel gene family FAM90A in primates originated by multiple duplication and rearrangement events Hum. Mol. Genet., November 1, 2007; 16(21): 2572 - 2582. [Abstract] [Full Text] [PDF]

				A Slavotinek, S S Lee, R Davis, A Shrit, K A Leppig, J Rhim, K Jasnosz, D Albertson, and D Pinkel Fryns syndrome phenotype caused by chromosome microdeletions at 15q26.2 and 8p23.1 J. Med. Genet., September 1, 2005; 42(9): 730 - 736. [Abstract] [Full Text] [PDF]

				A Sarkozy, E Conti, C Neri, R D'Agostino, M C Digilio, G Esposito, A Toscano, B Marino, A Pizzuti, and B Dallapiccola Spectrum of atrial septal defects associated with mutations of NKX2.5 and GATA4 transcription factors J. Med. Genet., February 1, 2005; 42(2): e16 - e16. [Full Text] [PDF]

				A Sarkozy, E Conti, D Seripa, M C Digilio, N Grifone, C Tandoi, V M Fazio, V Di Ciommo, B Marino, A Pizzuti, et al. Correlation between PTPN11 gene mutations and congenital heart defects in Noonan and LEOPARD syndromes J. Med. Genet., September 1, 2003; 40(9): 704 - 708. [Full Text] [PDF]

				J R Vermeesch, R Thoelen, I Salden, M Raes, G Matthijs, and J-P Fryns Mosaicism del(8p)/inv dup(8p) in a dysmorphic female infant: a mosaic formed by a meiotic error at the 8p OR gene and an independent terminal deletion event J. Med. Genet., August 1, 2003; 40(8): e93 - 93. [Full Text] [PDF]

				C-H Tsai, S L Graw, and L McGavran 8p23 duplication reconsidered: is it a true euchromatic variant with no clinical manifestation? J. Med. Genet., October 1, 2002; 39(10): 769 - 774. [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Giglio, S. Articles by Zuffardi, O. Search for Related Content PubMed PubMed Citation Articles by Giglio, S. Articles by Zuffardi, O. Related Collections Clinical genetics Cardiac development Genetics of cardiovascular disease