(Circulation. 2000;102:432.)
© 2000 American Heart Association, Inc.
Clinical Investigation and Reports |
From the Biologia Generale e Genetica Medica, Università di Pavia, Pavia, Italy (S.G., B.P., E.R., C. Dellavecchia, C. Danesino, O.Z.); the Eleanor Roosevelt Institute, Denver, Co (S.L.G.); the Laboratorio di Citogenetica and Divisione di Cardiochirurgia, Istituto G. Gaslini, Genova, Italy (G.G., P.V., F.L.); the Murdoch Institute, Royal Childrens Hospital, Parkville, Australia (L.V.); the Istituto Scientifico E. Medea, Bosisio Parini, Lecco, Italy (M.C.B); the Genetica Medica e Cardiologia, Ospedale Bambin Gesù, Rome, Italy (M.C.D., A.G., B.M.); Medical Genetics Division, Department of Pediatrics, Cedars-Sinai Medical Center, Los Angeles, Calif (J.R.K.); University of Colorado Health Sciences Center, Denver, Co (E.S.); the University La Sapienza and Istituto CSS-Mendel, Rome, Italy (B.D); and the Ospedale San Raffaele, Milan, Italy (R.C., O.Z.).
| Abstract |
|---|
|
|
|---|
1 gene located in 8p23
behaves as a dominant mutation, impairing heart differentiation and
leading to a wide spectrum of congenital heart defects (CHDs),
including conotruncal lesions, atrial septal defects,
atrioventricular canal defects, and pulmonary
valve stenosis. An 8p heart-defectcritical region was
delineated, and the zinc finger transcription factor GATA4 was
considered a likely candidate for these defects. We narrowed this
region and excluded a major role of GATA4 in these CHDs.
Methods and ResultsWe studied 12 patients (7 had CHD and 5 did
not) with distal 8p deletions from 9 families by defining their
chromosome rearrangements at the molecular level by fluorescent
in situ hybridization and short-tandem repeat analysis.
Subjects with 8p deletions distal to D8S1706, at
10 cM from the 8p
telomere, did not have CHD, whereas subjects with a deletion that
included the more proximal region suffered from the spectrum of heart
defects reported in patients with 8p distal deletions. The 5-cM
critical region is flanked distally by D8S1706 and WI-8327, both at
10 cM, and proximally by D8S1825, at 15 cM. Neither GATA4 nor
angiopoietin-2 (ANGPT2; a gene in 8p23 involved in blood vessel
formation) were found to be deleted in some of the critical patients.
We also found that CHDs are not related to the parental origin of
deletion.
ConclusionsHaploinsufficiency for a gene between WI-8327 and D8S1825 is critical for heart development. A causal relationship does not seem to exist between GATA4 and ANGPT2 haploinsufficiency and CHDs.
Key Words: heart defects, congenital chromosomes, 8 gene deletion GATA4 ANGPT2
| Introduction |
|---|
|
|
|---|
A wide spectrum of heart defects, including conotruncal anomalies, ventricular or atrial septal defects, pulmonary valve stenosis, patent ductus arteriosus, and persistent left superior vena cava, have been reported in patients with distal 8p deletions.6 7 8 9 10 11 12 13 14 It is unclear at present if a single gene or several genes in this region have a role in heart differentiation. Devriendt et al14 defined an 8p heart-defectcritical region spanning a 10-cM segment defined distally by D8S1706 and proximally by D8S1759, and they suggested the transcription factor GATA4 as a candidate gene. We narrowed this region by studying 12 del(8p) patients, including 6 new cases, 7 of whom had CHDs. We also excluded a major role of GATA4 and angiopoietin-2 (ANGPT2) in these CHDs.
| Methods |
|---|
|
|
|---|
|
Cytogenetics and Molecular Analysis
Lymphoblastoid cell lines were prepared from all patients after
informed consent was obtained from them or their parents.
Conventional cytogenetic and fluorescent in situ hybridization
(FISH) analyses were performed on lymphocyte chromosome
preparations from all patients. Yeast artificial chromosomes
(YACs) spread in 8p from the CEPH human Mega-YAC library were obtained
from Italian Genome Resources (IGeR). Subtelomeric sequences for
chromosome 16q (Oncor Appligene) were used to investigate the
reciprocity of the translocation t(8;16) in the father of case 10. FISH
with P1 artificial chromosomes (PACs) containing GATA4 and ANGPT2 was
performed to assess the involvement of these factors in the deleted
critical region.
Short-tandem repeat polymorphisms (STRPs) at 8p loci were examined in patients 1, 3, 4, 7, 9, 11, and 12 and in some of their parents using routine methods with primers purchased from Research Genetics.
Screening of the human genomic PAC libraries (Genome Systems) was performed to obtain PACs related to GATA4 and ANGPT2. Primers for GATA4 were forward CCCCTCTTCCCTCCTCAAAT and reverse TTCCCCTGGCCGGGTTGTCG (D78260 GenBank accession number); for ANGPT2, they were forward CCCAGTCCACCTGAGGAACT and reverse TGCTTTGGTCCGTTAAGTGATG (AF004327 GenBank accession number). These primers were from cDNA sequences given in the 5' to 3' direction.
| Results |
|---|
|
|
|---|
|
|
Cases 1 and 2 showed the most distal deletions, covering <9 cM from
D8S277 to the telomere (Figure 1a
). The
parents of case 1 had normal karyotypes. The absence of paternal
alleles at informative loci (Figure 2a
) indicated that the deletion was
inherited from the father. Deletions in cases 3 through 5, which were
previously defined as pter-D8S277,15 were refined by FISH
as pter-D8S1819, an interval of 10 cM from the 8p telomere (Figure 1b
). These rearrangements are maternal in
origin.15
|
|
In case 6, FISH analysis defined the 8p breakpoint to a 5-cM
region between WI-8327 and D8S1825. The patients father had a
reciprocal translocation t(8;16) (Figures 1c
and 1d
). Case 7 was
a recombinant 8 patient of Hispanic origin.9 FISH
analysis in the proposita assigned the 8p breakpoint to
between WI-8327 and D8S1825 (Figure 1e
); the deletion spanned an
interval of
15 cM. FISH analysis in case 8, which was
previously reported as 46,XY, del(8)(p23),8 disclosed a
11-cM interstitial deletion from WI-8327 to D8S1130 (Figure 1f
). The patients parents had normal karyotypes.
Chromosome and FISH analysis in the parents of case 10
revealed a paternal translocation of t(8;16)(p23.1;q24). YAC
920-D-12 (CHLC.GATA25C10-D8S552) spanned the derivative
chromosome 8 breakpoint (Figure 1g
), and the subtelomeric 16q
specific sequences were found on der(8) (data not shown). Thus, the
rearranged chromosome 8 in cases 9 and 10 was interpreted as der(8),
t(8;16) (p23.1;q24). The deletion spanned an interval of
26 cM, from
D8S552 to 8pter. STRP analyses in cases 11 and 12 and their
parents showed that the deletions were larger compared with those in
other patients and that they were, respectively, maternal and paternal
in origin (Figures 2b
and 2c
).
In summary, the deletions clustered within an 8- to 10-cM segment at
distal 8p in cases 1 through 5, who did not have CHDs. The deletions
were more proximally located in cases 6 to 12, who had CHDs. The
smallest region of deletion overlap associated with a CHD was between
WI-8327, the most proximal sequence-tagged site of contig WC8.0,
and D8S1825, the most distal sequence-tagged site of contig WC8.1. In
addition, FISH analysis with 2 GATA4 PACs revealed signals in
the abnormal chromosome 8 in cases 6 and 7 and an absence in the
deleted chromosome 8 in case 8 (Figure 3
); FISH with one ANGPT2 PAC revealed
signals in the abnormal chromosome 8 in case 8 but not in cases 6 and 7
(data not shown). These observations assign GATA4 as proximal to
D8S1825 and distal to D8S1130 and ANGPT2, which was previously located
between WI-3823 and CHCL.GCT18CO2,16 distal to
D8S1825.
|
| Discussion |
|---|
|
|
|---|
1 genes critical
for heart differentiation are likely to be located. We found that all
subjects with a deletion within this region (cases 6 to 12) had CHDs,
whereas those with more distal deletions spanning from D8S1819 to the
telomere (cases 1 to 5), did not. In case 6, the deletion is concurrent
with trisomy 1q42-qter, which is an inconsistent cause of
CHDs.17 Because the breakpoint at 8p was disrupting the 8p
heart-defectcritical region, a relationship of pulmonary
stenosis with the rearrangement at 8p is more likely than the
duplication of 1q. In cases 9 and 10, the 8p deletion was concurrent
with a duplication of 16q24, which per se does not associate with
CHDs.18 Thus, in these cases, CHDs are likely due to del
8p. A consistent involvement of laterality defects was suggested in patients with distal del8p and CHDs; this was based on the nonrandom occurrence of atrioventricular canal defects, abnormalities of the pulmonary and systemic vein returns, pulmonary stenosis, single ventricle, transposition of the great arteries, and dextrocardia.13 Additional CHDs associated with del 8p include atrial septal defects, patent ductus arteriosus, truncus arteriosus, double-outlet right ventricle, tetralogy of Fallot, and mitral atresia/stenosis.12 13 14 A similar wide spectrum of different CHDs also occurs in patients with recombinant 8 syndrome.9 19 Our case 7 is a member of this extended family. These observations either suggest that a cluster of genes affecting heart differentiation is located on the distal chromosome 8p and the haploinsufficiency of each of them results in distinct CHDs or that a single gene in this region is critical for cardiac morphogenesis. Molecular investigations of 8p deletion in our cases 6 through 8 have narrowed the critical region to the 5-cM interval between D8S1825 and WI-8327.
An 8p heart-defectcritical region has been assigned to a 10-cM interval between D8S1706 and D8S1759.14 Because GATA4 affects the initial steps of cardiac morphogenesis20 and was deleted in 5 patients with del 8p and CHDs and was present in one patient without CHDs, Devriendt et al14 considered this gene a candidate for heart defects associated with distal 8p deletions. Additional observations in other patients have supported a causal relationship between GATA4 haploinsufficiency and CHDs.21 The present results showed that GATA4 was deleted in case 8 but not in cases 6 and 7. These observations do not support a causal relationship between a deficiency of this gene product and 8p-CHD. Similarly, it is unlikely that ANGPT2, a member of the vascular endothelial growth factor localized to 8p23,16 is involved in these CHDs because it was not deleted in case 8. However, an impaired expression of these genes by a positional effect cannot be excluded. The present results also exclude any imprinting effect in CHDs associated with del 8p, which occur both in patients with paternally (cases 6, 7, 10, and 11) and maternally inherited (cases 9 and 12) deletions.
| Acknowledgments |
|---|
| Footnotes |
|---|
Received December 31, 1999; revision received February 14, 2000; accepted February 28, 2000.
| References |
|---|
|
|
|---|
2. Burn J, Brennan P, Little J, et al. Recurrence risks in offspring of adults with major heart defects: results from first cohort of British collaborative study. Lancet. 1998;351:311316.[Medline] [Order article via Infotrieve]
3. Li QY, Newbury-Ecob RA, Terrett JA, et al. Holt-Oram syndrome is caused by mutations in TBX5, a member of the Brachyury (T) gene family. Nat Genet. 1997;15:2129.[Medline] [Order article via Infotrieve]
4. Curran ME, Atkinson DL, Ewart AK, et al. The elastin gene is disrupted by a translocation associated with supravalvular aortic stenosis. Cell. 1993;73:159168.[Medline] [Order article via Infotrieve]
5. Linday EA, Botta A, Jurecic V, et al. Congenital heart disease in mice deficient for the diGeorge syndrome region. Nature. 1999;401:379383.[Medline] [Order article via Infotrieve]
6. Marino B, Reale A, Giannotti A, et al. Nonrandom association of atrioventricular canal and del (8p) syndrome. Am J Med Genet. 1992;42:424427.
7. Digilio MC, Giannotti A, Marino B, et al. Atrioventricular canal and 8p-syndrome. Am J Med Genet. 1993;47:437438.
8.
Hutchinson R, Wilson M, Voullaire L. Distal 8p
deletion (8p23.18pter): a common deletion? J Med
Genet. 1992;29:407411.
9. Sujanski E, Smith ACM, Prescott KE, et al. Natural history of the "recombinant 8" syndrome. Am J Med Genet. 1993;47:512525.[Medline] [Order article via Infotrieve]
10. Wu BL, Schneider GH, Sabatino DE, et al. Distal 8p deletion (8)(p23): an easily missed chromosome abnormality that may be associated with congenital heart defect and mental retardation. Am J Med Genet. 1996;62:7783.[Medline] [Order article via Infotrieve]
11. Claeys I, Holvoet M, Eyskens B, et al. A recognisable behavioral phenotype associated with terminal deletions of the short arm of chromosome 8. Am J Hum Genet. 1997;74:515520.
12. Johnson MC, Hing A, Wood MK, et al. Chromosome abnormalities in congenital heart disease. Am J Med Genet. 1997;70:292298.[Medline] [Order article via Infotrieve]
13. Digilio MC, Marino B, Guccione P, et al. Deletion 8p syndrome. Am J Med Genet. 1998;75:534536.[Medline] [Order article via Infotrieve]
14. Devriendt K, Matthijs G, Van Dael R, et al. Delineation of the critical deletion region for congenital heart defects on chromosome 8p23.1. Am J Hum Genet. 1999;64:11191126.[Medline] [Order article via Infotrieve]
15. Floridia G, Piantanida M, Minelli A, et al. The same molecular mechanism, in the maternal meiosis I, produces mono- and dicentric 8p duplications. Am J Hum Genet. 1996;58:785796.[Medline] [Order article via Infotrieve]
16. Cheung AH, Stewart RJ, Marsden PA. Endothelial Tie2/Tek ligands angiopoietin-1 (ANGPT1) and angiopoietin-2 (ANGPT2): regional localization of the human genes to 8q22.3 and 8p23. Genomics. 1998;98:389391.
17. Johnson VP. Duplication of the distal part of the long arm of chromosome 1. Am J Med Genet. 1991;39:258269.[Medline] [Order article via Infotrieve]
18.
Houlston RS, Renshaw RM, James RS, et al. Duplication
16q22-qter confirmed by fluorescence in situ hybridisation and
molecular analysis. J Med Genet. 1994;31:884887.
19. Gelb BD, Towbin JA, McCabe ERB, et al. San Luis Valley recombinant chromosome 8 and tetralogy of Fallot: a review of chromosome 8 anomalies and congenital heart disease. Am J Med Genet. 1991;40:471476.[Medline] [Order article via Infotrieve]
20. Grepin C, Robitaille L, Antakly T, et al. Inhibition of transcription factor GATA4 expression blocks in vitro cardiac muscle differentiation. Mol Cell Biol. 1 1995;5:40954102.
21. Pehlivan T, Pober BR, Brueckner M, et al. GATA4 haploinsufficiency in patients with interstitial deletion of chromosome region 8p23.1 and congenital heart disease. Am J Med Genet. 1999;83:201206.[Medline] [Order article via Infotrieve]
This article has been cited by other articles:
![]() |
C. Saffirio, B. Marino, and M. C. Digilio GATA4 as Candidate Gene for Pericardial Defects Ann. Thorac. Surg., December 1, 2007; 84(6): 2137 - 2137. [Full Text] [PDF] |
||||
![]() |
A Tomita-Mitchell, C L Maslen, C D Morris, V Garg, and E Goldmuntz GATA4 sequence variants in patients with congenital heart disease J. Med. Genet., December 1, 2007; 44(12): 779 - 783. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Bosch, M. Caceres, M. F. Cardone, A. Carreras, E. Ballana, M. Rocchi, L. Armengol, and X. Estivill Characterization and evolution of the novel gene family FAM90A in primates originated by multiple duplication and rearrangement events Hum. Mol. Genet., November 1, 2007; 16(21): 2572 - 2582. [Abstract] [Full Text] [PDF] |
||||
![]() |
A Slavotinek, S S Lee, R Davis, A Shrit, K A Leppig, J Rhim, K Jasnosz, D Albertson, and D Pinkel Fryns syndrome phenotype caused by chromosome microdeletions at 15q26.2 and 8p23.1 J. Med. Genet., September 1, 2005; 42(9): 730 - 736. [Abstract] [Full Text] [PDF] |
||||
![]() |
A Sarkozy, E Conti, C Neri, R D'Agostino, M C Digilio, G Esposito, A Toscano, B Marino, A Pizzuti, and B Dallapiccola Spectrum of atrial septal defects associated with mutations of NKX2.5 and GATA4 transcription factors J. Med. Genet., February 1, 2005; 42(2): e16 - e16. [Full Text] [PDF] |
||||
![]() |
A Sarkozy, E Conti, D Seripa, M C Digilio, N Grifone, C Tandoi, V M Fazio, V Di Ciommo, B Marino, A Pizzuti, et al. Correlation between PTPN11 gene mutations and congenital heart defects in Noonan and LEOPARD syndromes J. Med. Genet., September 1, 2003; 40(9): 704 - 708. [Full Text] [PDF] |
||||
![]() |
J R Vermeesch, R Thoelen, I Salden, M Raes, G Matthijs, and J-P Fryns Mosaicism del(8p)/inv dup(8p) in a dysmorphic female infant: a mosaic formed by a meiotic error at the 8p OR gene and an independent terminal deletion event J. Med. Genet., August 1, 2003; 40(8): e93 - 93. [Full Text] [PDF] |
||||
![]() |
C-H Tsai, S L Graw, and L McGavran 8p23 duplication reconsidered: is it a true euchromatic variant with no clinical manifestation? J. Med. Genet., October 1, 2002; 39(10): 769 - 774. [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2000 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |