Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation
Search: search_blue_button Advanced Search
Circulation. 2000;102:326-331

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Birks, E. J.
Right arrow Articles by Yacoub, M. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Birks, E. J.
Right arrow Articles by Yacoub, M. H.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Medline Plus Health Information
*Heart Failure
*Heart Transplantation
*Organ Donation
Related Collections
Right arrow Other myocardial biology
Right arrow Other heart failure
Right arrow Apoptosis
Right arrow Gene expression
Right arrow Growth factors/cytokines
Right arrow Heart failure - basic studies
Right arrow Echocardiography
Right arrow CV surgery: transplantation, ventricular assistance, cardiomyopathy
Right arrow Acute Cerebral Hemorrhage
Right arrow Autonomic, reflex, and neurohumoral control of circulation

(Circulation. 2000;102:326.)
© 2000 American Heart Association, Inc.


Clinical Investigation and Reports

Tumor Necrosis Factor-{alpha} Is Expressed in Donor Heart and Predicts Right Ventricular Failure After Human Heart Transplantation

Emma J. Birks, MRCP; Virginia J. Owen, PhD; Paul B. J. Burton, MBBS, PhD; Anne E. Bishop, PhD; Nicholas R. Banner, FRCP; Asghar Khaghani, FRCS; Julia M. Polak, DSc; Magdi H. Yacoub, FRS

From the National Heart and Lung Institute at the Imperial College School of Medicine, Royal Brompton and Harefield Hospital, Harefield, Middlesex, UK (E.J.B., V.J.O., P.B.J.B., N.R.B., A.K., M.H.Y.), and the Department of Histochemistry, Hammersmith Hospital at the Imperial College School of Medicine, London, UK (A.E.B., J.M.P.).

Correspondence to Magdi Yacoub, FRS, Professor of Cardiothoracic Surgery, Heart Science Centre, Royal Brompton and Harefield Hospital, Harefield, Middlesex UB9 6JH, United Kingdom.


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Background—Myocardial failure is an important problem after heart transplantation. Right ventricular (RV) failure is most common, although its mechanisms remain poorly understood. Inflammatory cytokines play an important role in heart failure. We studied the expression of tumor necrosis factor (TNF)-{alpha} and other cytokines in donor myocardium and their relationship to the subsequent development of RV failure early after transplantation.

Methods and Results—Clinical details were obtained, and ventricular function was assessed by transesophageal echocardiography in 26 donors before heart retrieval. A donor RV biopsy was obtained immediately before transplantation, and each recipient was followed for the development of RV failure. Reverse transcriptase–polymerase chain reaction was performed to detect TNF-{alpha}, interleukin-2, interferon-{gamma}, and inducible nitric oxide synthase expression. Eight of 26 recipients (30.8%) developed RV failure. Seven of these 8 (87.5%) expressed TNF-{alpha}, but only 4 of the 18 (22.2%) who did not develop RV failure expressed TNF-{alpha} (P<0.005). As a predictor of RV failure, TNF-{alpha} mRNA had a sensitivity of 87.5%, a specificity of 83.3%, a positive predictive value of 70%, and a negative predictive value of 93.7%. Western blotting demonstrated more TNF-{alpha} protein in the myocardium of donor hearts that developed RV failure (658±60 versus 470±57 optical density units, P<0.05). Immunocytochemistry localized TNF-{alpha} expression to cardiac myocytes. Reverse transcriptase–polymerase chain reaction detected interferon-{gamma} in 2 (7.7%), interleukin-2 in 1 (3.8%), and inducible nitric oxide synthase mRNA in 1 (3.8%) of the 26 donor hearts, none of which developed RV failure.

Conclusions—TNF-{alpha} expression in donor heart cardiac myocytes seems to predict the development of RV failure in patients early after heart transplantation.


Key Words: transplantation • myocardium • contractility


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Asignificant number (>=20%) of cardiac donors are not used for transplantation because of poor donor myocardial function,1 and 30%2 of early deaths after transplantation reported by the Registry of the International Society of Heart and Lung Transplantation occur because of myocardial failure. Right ventricular (RV) dysfunction is most commonly seen3 in the clinical setting; this is the result of either elevated pulmonary vascular resistance in the recipient or donor myocardial dysfunction. Experimental evidence suggests that the right ventricle is more susceptible to ischemia-reperfusion injury than the left ventricle.4 Both RV and left ventricular dysfunction occur after brain death in potential organ donors. Experimental studies have shown more pronounced changes in RV function.3 5 6 7 The mechanisms producing RV dysfunction remain poorly understood.

Patients with chronic heart failure due to a variety of causes have an elevated expression of the proinflammatory cytokines, including tumor necrosis factor (TNF)-{alpha}, both in the serum and myocardium.8 9 10 11 12 13 14 15 TNF-{alpha} depresses myocardial contractile function,15 16 17 either directly or through the induction of inducible nitric oxide synthase (iNOS). The proinflammatory cytokines interleukin (IL)-2 and interferon-{gamma} (IFN-{gamma}) can induce TNF-{alpha} production.18

Therefore, we investigated the relationship between the myocardial expression of TNF-{alpha} and other cytokines in the myocardium of donor hearts and the development of right heart failure early after transplantation, as well as the possible mechanisms of its induction and/or action in this setting.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Donors
Donor details are shown in the TableDown. Ten were domino hearts (from patients undergoing heart-lung transplantation) and 16 were hearts from brain-dead donors. Causes of death were subarachnoid hemorrhage (n=8), intracranial infarct (n=3), head injury (n=2), subdural hemorrhage (n=1), asthma (n=1), and meningitis (n=1). Infection in both the living and brain-dead donors was defined as a raised white cell count combined with either pyrexia or evidence of consolidation on a chest x-ray. The protocol was approved by the Hillingdon Health Authority Ethics Committee. Transesophageal echocardiograms at the time of retrieval showed that all the donors had an ejection fraction >55%. Mean central venous pressure was 8.9±1.0 mm Hg (range, 4 to 16 mm Hg). Preservation of the donor heart was done by the infusion of St Thomas’ solution at 4°C. Mean ischemia time was 134±11 minutes (range, 35 to 210 minutes). RV endomyocardial biopsies were obtained from the donor heart immediately before implantation and frozen in liquid nitrogen for analyses with reverse transcriptase–polymerase chain reaction (RT-PCR) and Western blotting. A further biopsy was fixed in 10% formal saline for immunocytochemistry.


View this table:
[in this window]
[in a new window]
 
Table 1. Donor Details

Recipients
The recipients of the donor hearts included 21 men and 5 women with a mean age 46.8 years (range, 27 to 62 years). Indications for transplantation were dilated cardiomyopathy (n=13), ischemic heart disease (n=11), postpartum cardiomyopathy (n=1), and myocarditis (n=1). New York Heart Association class before transplantation was III in 19 recipients and IV in 7 recipients. Before transplantation, mean pulmonary artery pressure was 29.2±2 mm Hg, mean pulmonary capillary wedge pressure was 20.7±2 mm Hg, mean transpulmonary gradient was 8.3±1 mm Hg, and pulmonary vascular resistance ranged from 1 to 8 Wood units (mean, 3.5±0.6 Wood units).

Development of right heart failure was defined as a dilated, poorly contracting right ventricle observed by transesophageal echocardiography in the presence of low cardiac output syndrome (defined as >=2 of the following: urine output <0.5 mL · kg-1 · h-1, inotrope [epinephrine or norepinephrine] requirements of >0.5 µg · kg-1 · min-1 necessary to maintain a systolic blood pressure >90 mm Hg, cardiac index <2, and progressive metabolic acidosis) and in the presence of adequate left atrial filling pressures.

RT-PCR
RT-PCR was performed for TNF-{alpha}, IL-2, IFN-{gamma}, and iNOS on all donor biopsies.

RNA Extraction and Preparation of cDNA
Total RNA was extracted from donor RV biopsies as described previously.19 cDNA was prepared by reverse transcription of 500 ng of total RNA with Moloney murine leukemia virus RT (Rnase reverse transcriptase) enzyme using oligo (dT)12–18 as a primer. After transcription at 37°C for 60 minutes, the reaction mixture was denatured at 95°C for 5 minutes, chilled on ice, and stored at -20°C until required for PCR amplification.

PCR Amplification
cDNA was amplified in a PCR reaction containing 20 µmol/L each deoxynucleotide triphosphate, 20 pmol/L each primer, 50 mol/L KCl, 10 mmol/L Tris HCl (pH 8.4), 0.1 mg/mL gelatin (Sigma), and 1 to 1.5 mmol/L MgCl2. A total of 45 amplification cycles with denaturation at 94°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C were performed. Products were analyzed by ethidium bromide staining after gel electrophoresis.

Oligonucleotide primers to TNF-{alpha}, iNOS, and GAPDH were designed in-house from published sequences. Sequences for TNF-{alpha} were as follows: TNF-{alpha} sense: CACCACGCTCTTCTGCCTGC (HUMTNFAA 217 to 236) and antisense: TCTCAGCTCCACGCCATT (HUMTNFAA 445 to 426). iNOS and GAPDH primers have been described previously20 ; they were as follows: iNOS sense ATTGATCAGAAGCTGTCCC (HUMINOSA 2127 to 2145), antisense: GTAGATTCTGCCCAGATTTG (HUMINOS 2392 to 2411), GAPDH sense: TCACCATCTTCCAGGAGCGA (HSGAPDR 281 to 300), and antisense: TCCTTGGAGGCCATGTGGGC (HSGAPDR 1045 to 1064).

IFN-{gamma} primers were described previously,21 and IL-2 primers were commercially available (Clontech Laboratories, Inc). All primers were intron-spanning.

Western Blot Analysis
Total protein extracts were prepared from 18 of the donor biopsies (in which sufficient tissue was available), 7 of which developed RV failure, by homogenising myocardial biopsies in lysis buffer (1% SDS, 1 mmol/L phenylmethylsulfonylfluoride, 10 µg/mL aprotinin, and 10 µg/ml leupeptin). Protein (40 µg per sample) was loaded onto a 12.5% SDS-polyacrylamide gel. After electrophoresis, proteins were transferred onto Hybond-C super nitrocellulose membranes. Membranes were immersed in PBS-Tween 20 and 5% milk protein overnight at 4°C to block nonspecific binding. Primary TNF-{alpha} (Santa-Cruz Biotechnology), diluted 1:500 (v/v) in PBS-Tween 20/5% milk protein, was added to the membranes for 60 minutes. After washing, membranes were subsequently incubated with a horseradish-peroxidase–conjugated rabbit anti-goat secondary antibody (DAKO) diluted 1/1000 (v/v) in PBS-Tween 20/35% milk protein for 1 hour. The immunoreactive bands were visualized using Amersham electrogenerated chemiluminescent reagents, and they were scanned using Image Analysis 1000 software (Alpha Innotech).

Immunocytochemistry
Immunocytochemistry was performed on formalin-fixed paraffin-embedded sections from 17 donor hearts (in which sufficient tissue was available), 6 of which developed RV failure, to localize the cell type producing TNF-{alpha}. The avidin-biotin-peroxidase complex method22 was used. Endogenous peroxidase was blocked with 0.03% (v/v) hydrogen peroxide in methanol for 20 minutes. After incubation with normal goat serum (1:30, 30 minutes), sections were incubated overnight at 4°C with primary rabbit antibodies to TNF-{alpha} (Antigenex America Inc), diluted 1:100 (v/v). Immunoreaction sites were visualized using the appropriate biotinylated secondary antibodies and the avidin-biotin-peroxidase complex procedure (Vector Labs). Peroxidase activity was revealed with a solution of diaminobenzidine as chromogen with 0.2% (v/v) hydrogen peroxide in PBS to produce a brown reaction product; sections were counterstained with Harris’ hematoxylin. Controls consisted of the replacement of primary antibodies with nonimmune rabbit serum. Semiquantitative analysis was performed using a BH-60 microscope (Olympus). The degree of TNF-{alpha} expression was assessed by 2 independent observers and graded on a scale from 1 to 3 for each cell type in each biopsy.

Statistics
Variables are expressed as mean±SEM. Fisher’s exact test using a 2x2 contingency table and Student’s t test were used for the analysis. The sensitivity, specificity, positive predictive values, and negative predictive values were calculated using standard formulae. P<0.05 was considered significant.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Heart Failure and Patient Outcome
Eight of the 26 patients (30.8%) developed right heart failure after transplantation. These patients had a significantly longer stay in the intensive therapy unit (mean, 4.1±0.7 days) than those who did not develop RV failure (mean, 1.4±0.27 days; P<0.001). Two of these 8 patients (25%) required intra-aortic balloon counterpulsation in the postoperative period, compared with none of the 18 who did not develop RV failure. Patients with RV failure spent a mean of 43.5±5 days in the hospital (including readmissions) in the first 3 postoperative months, compared with 30.2±3 days for those who did not develop RV failure (P<0.05).

TNF-{alpha} mRNA Expression
RT-PCR showed that 7 of the 8 patients (87.5%) who developed right heart failure expressed TNF-{alpha} mRNA compared with 4 of the 18 patients (22.2%) who did not (P<0.005). None of the known risk factors for the development of RV failure (such as donor age, preharvesting presence/absence of inotropes, ischemia time, or recipient transpulmonary gradient) was present in this group of patients. As a predictor of right heart failure, TNF-{alpha} had a sensitivity of 87.5%, a specificity of 83.3%, a positive predictive value of 70%, and a negative predictive value of 93.7% (Figure 1aDown). Of the 16 hearts from brain-dead donors, 7 (43.8%) developed RV failure and 6 of these 7 (85.7%) expressed TNF-{alpha} (Figure 1bDown).



View larger version (13K):
[in this window]
[in a new window]
 
Figure 1. Donor heart TNF-{alpha} expression and development of RV failure in (a) all donors and (b) brain-dead donors.

Ten of the 26 donor hearts (38.5%) were domino donor hearts; 9 of these were from cystic fibrosis patients and 1 was from a patient with primary pulmonary hypertension. Two of the 10 domino hearts (20%), both from patients with cystic fibrosis, expressed TNF-{alpha} mRNA. One of these 2 hearts developed RV failure after transplantation into a patient with a low transpulmonary gradient. The domino heart from the patient with primary pulmonary hypertension did not express TNF-{alpha} when transplanted into a patient with a high transpulmonary gradient. The other 7 domino hearts from patients with cystic fibrosis did not express TNF-{alpha} and did not develop RV failure when transplanted into patients with low transpulmonary gradients. All patients with cystic fibrosis had extensive chronic inflammatory changes with a large amount of purulent secretions in both lungs. In addition, 2 patients had evidence of active infection (pyrexia with growth of Proteus species in one and pyrexia in the other) at the time their heart was used for transplantation, but in neither heart was TNF-{alpha} expressed.

TNF-{alpha} expression was not affected by donor age, central venous pressure, period of ventilation, sex, smoking status, use of inotropes, or ischemia time (P=NS). TNF-{alpha} was not affected by the cause of death (TNF-{alpha} was positive in 3 of the 8 donors with subarachnoid hemorrhage, 2 of the 3 with intracranial infarcts, the donor with a head injury, and the donors with subdural hemorrhage and asthma; it was not expressed in the donor with meningitis). TNF-{alpha} was not affected by the presence of donor infection (P=NS).

TNF-{alpha} Protein Expression by Western Blotting
Significantly higher TNF-{alpha} expression existed in the donor hearts of patients who developed right heart failure (658.9±60 optical density [OD] units, n=7) compared with those who did not (470.5±57 OD units, n=11; P<0.05) (Figure 2Down). A strong trend existed for higher TNF-{alpha} protein expression in the donors expressing TNF-{alpha} mRNA (637.3±71 OD units) compared with those who did not (474.3±61 OD units, P=0.07).



View larger version (8K):
[in this window]
[in a new window]
 
Figure 2. Densitometric analysis of protein bands from Western blots incubated with TNF-{alpha} antibody shows significantly higher TNF-{alpha} expression in the myocardium of the group of 7 donor hearts that developed right heart failure (RSHF) compared with the 11 that did not (Non RSHF).

TNF-{alpha} Expression by Immunocytochemistry
TNF-{alpha} expression was localized to cardiac myocytes (Figure 3Down); it was not expressed in vascular smooth muscle cells and was only occasionally expressed in endothelial cells (only one biopsy) (Figure 3Down). Semiquantitative analysis showed stronger TNF-{alpha} expression in the cardiac myocytes of patients developing right heart failure (score, 1.1±0.4 versus 0.6±0.1 arbitrary units) (Figure 3Down), although this did not reach statistical significance. A strong trend existed for higher TNF-{alpha} protein expression in cardiac myocytes from the donors who expressed TNF-{alpha} mRNA (1.1±0.3 versus 0.5±0.1 arbitrary units; P=0.09).



View larger version (134K):
[in this window]
[in a new window]
 
Figure 3. Photomicrographs showing (A) TNF-{alpha} immunostaining in cardiac myocytes and endothelial cells (from only one blood vessel) in a donor biopsy of a patient who subsequently developed RV failure and (B) the absence of TNF-{alpha} immunostaining in a donor biopsy from a patient who did not develop RV failure.

Other Cytokine Expression
RT-PCR detected IFN-{gamma} in 2 (7.7%), IL-2 in 1 (3.8%), and iNOS mRNA in 1 (3.8%) of the 26 donor hearts, and none of these hearts developed RV failure. Only one of the 2 hearts expressing IFN-{gamma} also expressed TNF-{alpha}, and the heart that expressed IL-2 did not express TNF-{alpha} mRNA. In the one heart with iNOS expression, no TNF-{alpha} expression occurred.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
This study documented, for the first time, a relationship between both TNF-{alpha} mRNA and protein expression in the myocardium of donor hearts and the development of right heart failure early after transplantation. Myocardial failure after transplantation remains an important problem,2 and it probably has a variety of causes, including the effects of brain death, donor management, and ischemia-reperfusion during harvesting and implantation.

Studies of cardiac function after brain death in experimental animals by Bittner and colleagues3 6 7 have shown that biventricular systolic function and contractility were significantly decreased after brain death. This impairment of function, however, was more prominent in the right than the left ventricle, with RV function decreasing by 35% and left ventricular function by 19%.6 Although several mechanisms have been suggested,23 the cause of the decrease in ventricular function after brain death remains unclear. In an experimental model of ischemia-reperfusion, Mankad and Yacoub4 observed that the right ventricle was relatively more susceptible. In our patients, ischemia time was not different in patients who developed RV failure compared with those who did not, suggesting that a preexisting myocardial factor could be responsible.

In our study, we found a strong correlation between TNF-{alpha} mRNA and protein expression in the donor heart and the development of myocardial failure after transplantation. Immunocytochemistry localized the site of TNF-{alpha} expression to the cardiac myocyte in this study (Figure 3Up). It has previously been shown that cardiac myocytes can produce substantial amounts of TNF-{alpha}.24 A trend existed for TNF-{alpha} mRNA expression to correlate with protein expression, both in myocardial homogenates (Western blotting) and in myocytes (immunocytochemistry), although this was not statistically significant.

TNF-{alpha} is a proinflammatory cytokine15 that is released locally in response to infection and injury. Previous studies have shown elevated plasma concentrations of TNF-{alpha} in patients with heart failure.8 9 10 11 12 Furthermore, levels of TNF-{alpha} have been associated with decreasing patient functional status,10 11 and a trend has been found between higher TNF-{alpha} concentration and impaired survival.10 TNF-{alpha} expression has been demonstrated13 14 in the ventricles of patients with dilated cardiomyopathy, where it was seen in cardiac myocytes, endothelial cells, and in the vascular smooth muscle cells of intramyocardial blood vessels. A recent study25 showed that the unloading of the failing human heart by the placement of a left ventricular assist device is associated with a reduction in TNF-{alpha} expression. The greatest reduction occurred in patients who recovered cardiac function and were successfully weaned off the device, suggesting that the putative effect of the cytokines on myocardial function could be reversible.

The mechanism of TNF-{alpha} induction in our patients remains unknown. No relationship existed between TNF-{alpha} induction and infection, period of ventilation, smoking status, use of inotropes in the donor, or ischemia time. Although TNF-{alpha} production can be stimulated by pressure overload,26 no correlation existed between TNF-{alpha} expression and the central venous pressure of the donor before explantation. However, during and immediately after brain death, extensive changes in loading conditions occur. In our study, the correlation between TNF-{alpha} mRNA expression and the development of right heart failure in the brain-dead donors suggests that TNF-{alpha} expression may result from brain death. Others have found27 that after the induction of brain death in the rat, TNF-{alpha} mRNA can be detected in the heart and other peripheral organs. In that study, IL-1, IL-2, IL-6, and IFN-{gamma} mRNA were also detected. No relationship existed between TNF-{alpha} expression and the cause of brain death in our study. TNF-{alpha} is likely to be upregulated very quickly in cardiac myocytes after brain death because it is an "acute phase reactant." This is analogous to the clinical situation of cardiopulmonary bypass in which TNF expression has also been observed.28

TNF-{alpha} production can be induced by the proinflammatory cytokines IL-2 and IFN-{gamma}.18 IL-2 was only detected in one donor in our series and that heart did not express TNF-{alpha}, and IFN-{gamma} was only detected in 2 donor hearts, one of which expressed TNF-{alpha}. This suggests that the expression of IL-2 and IFN-{gamma} is not the mechanism through which TNF-{alpha} is produced in our patients.

Bozkurt et al16 and Yokoyama et al17 showed that TNF-{alpha} can depress myocardial function. The hemodynamic effects of TNF-{alpha} are characterized by decreased myocardial contractile efficiency and reduced ejection fraction, hypotension, and biventricular dilatation.15 TNF-{alpha} may affect graft myocardial function through NO-dependent or NO-independent mechanisms. TNF-{alpha} can induce the expression of iNOS,20 29 which can result in the production of large quantities of NO.8 NO may have a negative inotropic effect.8 30 We found iNOS expression in only one donor heart, and this donor did not express TNF-{alpha}; this suggests that in the donor heart, TNF-{alpha} is acting through a NO-independent mechanism. TNF-{alpha} binds to 2 receptors, TNFR1 and TNFR2. Binding to TNFR1 results in sphingosine production, which decreases calcium transients and may lead to dysfunctional excitation-contraction coupling and to systolic and/or diastolic dysfunction.15 31 TNF-{alpha} can also induce the apoptosis of cardiac myocytes through a sphingosine-dependant mechanism.32 Furthermore, TNF-{alpha} causes a concentration-dependant increase in the inhibitory G protein Gi{alpha}33 in rat cardiac myocytes, and our group have previously demonstrated increased activity of Gi{alpha} in donor hearts with myocardial dysfunction.23 In addition, TNF-{alpha} has the potential to lead to heart failure through its effects on matrix metalloproteinases.34

The patients in our series who developed right heart failure had longer stays in the intensive therapy unit and spent more time in the hospital during the first 3 months after transplantation, which suggests that donor myocardial dysfunction affects patient outcome (as others have shown previously2 35 ) and increases the cost of patient care.

Modulation of TNF-{alpha} expression might avoid right heart failure in some recipients and could improve the function of "marginal" donors, which might lead to an expansion of the useable donor pool. Etanercept is a p75 TNF receptor fusion protein that binds to TNF-{alpha}, thus functionally inactivating it. When given to patients with New York Heart Association class III heart failure in a randomized double-blind trial, it increased their quality of life, 6-minute walk distances, and ejection fractions.36 Pentoxifylline is a xanthine derivative that suppresses or reduces the production of TNF-{alpha}37 and is thought to act at the mRNA level.38 Administration of pentoxifylline to patients with idiopathic dilated cardiomyopathy39 resulted in improved functional class, increased ejection fraction, and decreased TNF-{alpha} levels. When administered in an animal model40 of lung transplantation, pentoxifylline improved oxygen tension, pulmonary vascular resistance, and recipient survival.

Limitations
Although we demonstrated the expression of TNF-{alpha} in the right ventricle, we have no data relating to its expression in the left ventricle. Although there are plausible biological mechanisms by which TNF-{alpha} expression may lead to ventricular dysfunction, our study cannot prove that TNF-{alpha} is the only mechanism causing RV failure in these patients.

Conclusions
Our results suggest that TNF-{alpha} expression in the donor heart is an important predictor of the development of right heart failure early after transplantation and that TNF-{alpha} may contribute to myocardial dysfunction. Our results indicate that TNF-{alpha} does not act through an NO-dependant mechanism but may act through other pathways. Pharmacological modulation of TNF-{alpha} expression in organ donors may be a useful strategy for reducing post-transplant ventricular dysfunction.


*    Acknowledgments
 
We would like to thank Mahrokh Nohadani for her invaluable technical help. We would also like to thank the British Heart Foundation for their support (Project Grant Number 96152).

Received October 26, 1999; revision received February 11, 2000; accepted February 14, 2000.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Emery RW, Cork RC, Levinson MM, et al. The cardiac donor: a six year experience. Ann Thorac Surg. 1986;41:356–362.[Abstract]

2. Hosenpud JD, Bennett LE, Berkeley MK, et al. The registry of the International Society for Heart and Lung Transplantation: fifteenth official report-1998. J Heart Lung Transplant. 1998;17:656–668.[Medline] [Order article via Infotrieve]

3. Bittner HR, Kendall SWH, Chen EP, et al. Myocardial performance after graft preservation and subsequent cardiac transplantation from brain-dead donors. Ann Thorac Surg. 1995;60:47–54.[Abstract/Free Full Text]

4. Mankad P, Yacoub M. Influence of basal release of nitric oxide on systolic and diastolic function of both ventricles. J Thorac Cardiovasc Surg. 1997;113:770–776.[Abstract/Free Full Text]

5. Bizouarn P, Treilhaud M, Portier D, et al. Right ventricular function early after total or standard orthotopic heart transplantation. Ann Thorac Surg. 1994;57:183–187.[Abstract]

6. Bittner HB, Kendall SWH, Chen EP, et al. The combined effects of brain death and cardiac graft preservation on cardiopulmonary hemodynamics and function before and after subsequent heart transplantation. J Heart Lung Transplant. 1996;15:764–767.[Medline] [Order article via Infotrieve]

7. Bittner HB, Chen EP, Craig D, et al. Preload-recruitable stroke work relationships and diastolic dysfunction in the brain-dead organ donor. Circulation. 1996;94{suppl II}:II-320–II-325.

8. Birks EJ, Yacoub MH. The role of nitric oxide and cytokines in heart failure. Coron Artery Dis. 1997;8:389–402.[Medline] [Order article via Infotrieve]

9. Levine B, Kalman J, Mayer L, et al. Elevated circulating levels of tumor necrosis factor in severe chronic heart failure. N Engl J Med. 1990;323:236–241.[Abstract]

10. Torre-Amione G, Kapiada S, Benedict C, et al. Proinflammatory cytokine levels in patients with depressed left ventricular ejection fraction: a report from the studies of left ventricular dysfunction (SOLVD). J Am Coll Cardiol. 1996;27:1201–1206.[Abstract]

11. Lommi J, Pulkki P, Koskinen P, et al. Hemodynamic, neuroendocrine and metabolic correlates of circulating cytokine concentrations in congestive heart failure. Eur Heart J. 1997;18:1620–1625.[Abstract/Free Full Text]

12. Matsumori A, Yamada T, Suzuki H, et al. Increased circulating cytokines in patients with myocarditis and cardiomyopathy. Br Heart J. 1994;72:561–566.[Abstract/Free Full Text]

13. Satoh M, Nakamura M, Saitoh H, et al. Tumor necrosis factor-{alpha}-converting enzyme and tumor necrosis factor-{alpha} in human dilated cardiomyopathy. Circulation. 1999;99:3260–3265.[Abstract/Free Full Text]

14. Habib FM, Springall DR, Davies GJ, et al. Tumor necrosis factor and inducible nitric oxide synthase in dilated cardiomyopathy. Lancet. 1996;347:1151–1155.[Medline] [Order article via Infotrieve]

15. Meldrum DR. Tumor necrosis factor in the heart. Am J Physiol. 1998;274:R577–R595.

16. Bozkurt B, Kribbs SB, Clubb FJ, et al. Pathophysiologically relevant concentrations of tumor necrosis factor-{alpha} promote left ventricular dysfunction and remodeling in rats. Circulation. 1998;97:1382–1391.[Abstract/Free Full Text]

17. Yokoyama T, Vaca L, Rossen RD, et al. Cellular basis for the negative inotropic effects of tumor necrosis factor-alpha in the adult mammalian heart. J Clin Invest. 1993;92:2303–2312.

18. Smith CA, Farrah T, Goodwin RG. The TNF receptor superfamily of cellular and viral proteins: activation, costimulation and death. Cell. 1994;76:959–962.[Medline] [Order article via Infotrieve]

19. Chomczynski P, Sacci, N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987;162:156–159.[Medline] [Order article via Infotrieve]

20. Chester AHY, Borland JAA, Buttery LDK, et al. Induction of nitric oxide synthase in human vascular smooth muscle: interactions between pro-inflammatory cytokines. Cardiovasc Res. 1998;38:814–821.[Abstract/Free Full Text]

21. Bishop GA, Rokahr KL, Napoli J, et al. Intragraft cytokine mRNA levels in human liver allograft rejection analyzed by reverse transcription and semiquantitative polymerase chain reaction amplification. Transplant Immunol. 1993;1:253–261.[Medline] [Order article via Infotrieve]

22. Hsu SM, Raine L, Fanger H. Use of avidin-biotin-peroxidase complex (ABC) in immunoperoxidase techniques: a comparison between ABC and unlabeled antibody (PAP) procedures. J Histochem Cytochem. 1981;29:577–580.[Abstract]

23. Owen VJ, Burton P, Michel MC, et al. Myocardial dysfunction in donor hearts: a possible etiology. Circulation. 1999;99:2565–2570.[Abstract/Free Full Text]

24. Kapadia S, Lee J, Torre-Amione G, et al. Tumor necrosis factor-alpha gene and protein expression in adult feline myocardium after endotoxin administration. J Clin Invest. 1995;96:1042–1052.

25. Torre-Amione G, Stetson SJ, Youker KA, et al. Decreased expression of tumor necrosis factor-{alpha} in failing human myocardium after mechanical circulatory support: a potential mechanism for cardiac recovery. Circulation. 1999;100:1189–1193.[Abstract/Free Full Text]

26. Kapadia S, Oral H, Lee J, et al. Hemodynamic regulation of tumor necrosis factor-{alpha} gene and protein expression in adult feline myocardium. Circ Res. 1997;81:187–195.[Abstract/Free Full Text]

27. Takada M, Nadeau KC, Hancock WW, et al. Effects of explosive brain death on cytokine activation of peripheral organs in the rat. Transplantation. 1998;65:1533–1542.[Medline] [Order article via Infotrieve]

28. Menasche P. Inflammatory response to bypass and its impact on postoperative myocardial function. In: Yacoub MH, Carpentier AF, eds. Annual of Cardiac Surgery. 9th ed. London: Rapid Science Publishers; 1996:53–61.

29. Balligand J-L, Ungureanu-Longrois D, Simmons WW, et al. Cytokine-inducible nitric oxide synthase (iNOS) expression in cardiac myocytes: characterisation and regulation of iNOS expression and detection of iNOS activity in single cardiac myocytes in vitro. J Biol Chem. 1994;269:27580–27588.[Abstract/Free Full Text]

30. Shulz R, Panas DL, Catena R, et al. The role of nitric oxide in cardiac depression induced by interleukin-1ß and tumor necrosis factor-alpha. Br J Pharmacol. 1995;114:27–34.[Medline] [Order article via Infotrieve]

31. Oral H, Dorn GW, Mann DL. Sphingosine mediates the immediate negative inotropic effects of tumor necrosis factor-{alpha} in the adult mammalian cardiac myocyte. J Biol Chem. 1997;272:4836–4842.[Abstract/Free Full Text]

32. Krown KA, Page MT, Nguyen C, et al. Tumor necrosis factor alpha-induced apoptosis in cardiac myocytes: involvement of the sphingolipid signaling cascade in cardiac cell death. J Clin Invest. 1996;98:2854–2865.[Medline] [Order article via Infotrieve]

33. Reithmann C, Glerschick P, Werdan K, et al. Tumor necrosis factor-{alpha} up-regulates Gi alpha and G beta proteins and adenyl cyclase responsiveness in rat cardiomyocytes. Eur J Pharmacol. 1991;206:53–60.[Medline] [Order article via Infotrieve]

34. Mann DL, Spinale FG. Activation of matrix metalloproteinases in the failing human heart: breaking the tie that binds. Circulation. 1998;98:1699–1702.[Free Full Text]

35. Darracott-Cancovic S, Stovin PGI, Wheeldon D, et al. Effect of donor heart damage on survival after transplantation. Eur J Cardiothorac Surg. 1989;3:525–532.[Abstract]

36. Deswal A, Bozkurt B, Seta Y, et al. Safety and efficacy of a soluble P75 tumor necrosis factor receptor (Enbrel, Etanercept) in patients with advanced heart failure. Circulation. 1999;99:3224–3226.[Abstract/Free Full Text]

37. Waage A, Sorensen M, Stordal B. Differential effect of pentoxifylline on tumor necrosis factor and interleukin-6 production. Lancet. 1990;335:543.[Medline] [Order article via Infotrieve]

38. Kremsner PG, Grundmann H, Neifer S, et al. Pentoxifylline prevents murine cerebral malaria. J Infect Dis. 1991;164:605–608.[Medline] [Order article via Infotrieve]

39. Sliwa K, Skudicky D, Candy G, et al. Randomised investigation of effects of pentoxifylline on left-ventricular performance in idiopathic dilated cardiomyopathy. Lancet. 1998;351:1091–1093.[Medline] [Order article via Infotrieve]

40. Murakami S, Bacha EA, Herve P, et al. Inhaled nitric oxide and pentoxifylline in rat lung transplantation from non-heart beating donors. J Thorac Cardiovasc Surg. 1997;113:821–829.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
CirculationHome page
S. Aharinejad, O. Andrukhova, M. Gmeiner, A. Thomas, A. Aliabadi, A. Zuckermann, K. Krenn, and M. Grimm
Donor Serum SMARCAL1 Concentrations Predict Primary Graft Dysfunction in Cardiac Transplantation
Circulation, September 15, 2009; 120(11_suppl_1): S198 - S205.
[Abstract] [Full Text] [PDF]


Home page
Eur. J. Cardiothorac. Surg.Home page
R. V. Venkateswaran, J. S. Ganesh, J. Thekkudan, R. Steeds, I. C. Wilson, J. Mascaro, R. Thompson, and R. S. Bonser
Donor cardiac troponin-I: a biochemical surrogate of heart function
Eur. J. Cardiothorac. Surg., August 1, 2009; 36(2): 286 - 292.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
J. D. McCully, M. K. Bhasin, C. Daly, M. C. Guerrero, S. Dillon, T. A. Liberman, D. B. Cowan, J. D. Mably, F. X. McGowan, and S. Levitsky
Transcriptomic and proteomic analysis of global ischemia and cardioprotection in the rabbit heart
Physiol Genomics, July 9, 2009; 38(2): 125 - 137.
[Abstract] [Full Text] [PDF]


Home page
Ann. Thorac. Surg.Home page
R. M. Osipov, C. Bianchi, R. T. Clements, J. Feng, Y. Liu, S.-H. Xu, M. P. Robich, J. Wagstaff, and F. W. Sellke
Thrombin Fragment (TP508) Decreases Myocardial Infarction and Apoptosis After Ischemia Reperfusion Injury.
Ann. Thorac. Surg., March 1, 2009; 87(3): 786 - 793.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
J. D. McCully, D. B. Cowan, C. A. Pacak, I. K. Toumpoulis, H. Dayalan, and S. Levitsky
Injection of isolated mitochondria during early reperfusion for cardioprotection
Am J Physiol Heart Circ Physiol, January 1, 2009; 296(1): H94 - H105.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
I. Bak, I. Lekli, B. Juhasz, N. Nagy, E. Varga, J. Varadi, R. Gesztelyi, G. Szabo, L. Szendrei, I. Bacskay, et al.
Cardioprotective mechanisms of Prunus cerasus (sour cherry) seed extract against ischemia-reperfusion-induced damage in isolated rat hearts
Am J Physiol Heart Circ Physiol, September 1, 2006; 291(3): H1329 - H1336.
[Abstract] [Full Text] [PDF]


Home page
Eur J Heart FailHome page
M. Odeh, E. Sabo, and A. Oliven
Circulating levels of tumor necrosis factor-{alpha} correlate positively with severity of peripheral oedema in patients with right heart failure
Eur J Heart Fail, March 1, 2006; 8(2): 141 - 146.
[Abstract] [Full Text] [PDF]


Home page
Eur. J. Cardiothorac. Surg.Home page
S. C. Stoica, D. K. Satchithananda, C. Atkinson, S. Charman, M. Goddard, and S. R. Large
Heat shock protein, inducible nitric oxide synthase and apoptotic markers in the acute phase of human cardiac transplantation
Eur. J. Cardiothorac. Surg., December 1, 2003; 24(6): 932 - 939.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
N. N. Chan, P. Vallance, and H. M. Colhoun
Endothelium-Dependent and -Independent Vascular Dysfunction in Type 1 Diabetes: Role of Conventional Risk Factors, Sex, and Glycemic Control
Arterioscler Thromb Vasc Biol, June 1, 2003; 23(6): 1048 - 1054.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
M. Eikmans, H. J. Baelde, E. C. Hagen, L. C. Paul, P. H. C. Eilers, E. de Heer, and J. A. Bruijn
Renal mRNA Levels as Prognostic Tools in Kidney Diseases
J. Am. Soc. Nephrol., April 1, 2003; 14(4): 899 - 907.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
D. L. Brutsaert
Cardiac Endothelial-Myocardial Signaling: Its Role in Cardiac Growth, Contractile Performance, and Rhythmicity
Physiol Rev, January 1, 2003; 83(1): 59 - 115.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
K. K. Koh
Effects of estrogen on the vascular wall: vasomotor function and inflammation
Cardiovasc Res, September 1, 2002; 55(4): 714 - 726.
[Full Text] [PDF]


Home page
J Am Coll CardiolHome page
G. Plenz, H. Eschert, M. Erren, T. Wichter, M. Bohm, M. Flesch, H. H. Scheld, and M. C. Deng
The interleukin-6/interleukin-6-receptorsystem is activated in donor hearts
J. Am. Coll. Cardiol., May 1, 2002; 39(9): 1508 - 1512.
[Abstract] [Full Text] [PDF]


Home page
Eur. J. Cardiothorac. Surg.Home page
H. Wakiyama, D. B. Cowan, Y. Toyoda, M. Federman, S. Levitsky, and J. D. McCully
Selective opening of mitochondrial ATP-sensitive potassium channels during surgically induced myocardial ischemia decreases necrosis and apoptosis
Eur. J. Cardiothorac. Surg., March 1, 2002; 21(3): 424 - 433.
[Abstract] [Full Text] [PDF]


Home page
Ann. Thorac. Surg.Home page
S. C. Stoica, M. Goddard, and S. R. Large
The endothelium in clinical cardiac transplantation
Ann. Thorac. Surg., March 1, 2002; 73(3): 1002 - 1008.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
M. J. Jarvisalo, T. Ronnemaa, I. Volanen, T. Kaitosaari, K. Kallio, J. J. Hartiala, K. Irjala, J. S. A. Viikari, O. Simell, and O. T. Raitakari
Brachial artery dilatation responses in healthy children and adolescents
Am J Physiol Heart Circ Physiol, January 1, 2002; 282(1): H87 - H92.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
P. E. LIGHT, H. D. KANJI, J. E. M. FOX, and R. J. FRENCH
Distinct myoprotective roles of cardiac sarcolemmal and mitochondrial KATP channels during metabolic inhibition and recovery
FASEB J, December 1, 2001; 15(14): 2586 - 2594.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
P. O. Iversen, G. Nicolaysen, and M. Sioud
DNA enzyme targeting TNF-alpha mRNA improves hemodynamic performance in rats with postinfarction heart failure
Am J Physiol Heart Circ Physiol, November 1, 2001; 281(5): H2211 - H2217.
[Abstract] [Full Text] [PDF]


Home page
Eur. J. Cardiothorac. Surg.Home page
S. C. Stoica, D. K. Satchithananda, J. Dunning, and S. R. Large
Two-decade analysis of cardiac storage for transplantation
Eur. J. Cardiothorac. Surg., October 1, 2001; 20(4): 792 - 798.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
F. D. Wagner, B. Jonitz, E. V. Potapov, N. Qedra, K. Wegscheider, K. Abraham, E. A. Ivanitskaia, M. Loebe, and R. Hetzer
Procalcitonin, A Donor-Specific Predictor of Early Graft Failure-Related Mortality After Heart Transplantation
Circulation, September 18, 2001; 104 (2009): I-192 - I-196.
[Abstract] [Full Text] [PDF]


Home page
Eur J Heart FailHome page
G. Plenz, Z. F. Song, T. D.T. Tjan, C. Koenig, H. A. Baba, M. Erren, M. Flesch, T. Wichter, H. H. Scheld, and M. C. Deng
Activation of the cardiac interleukin-6 system in advanced heart failure
Eur J Heart Fail, August 1, 2001; 3(4): 415 - 421.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
Y. Toyoda, I. Friehs, R. A. Parker, S. Levitsky, and J. D. McCully
Differential role of sarcolemmal and mitochondrial KATP channels in adenosine-enhanced ischemic preconditioning
Am J Physiol Heart Circ Physiol, December 1, 2000; 279(6): H2694 - H2703.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Birks, E. J.
Right arrow Articles by Yacoub, M. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Birks, E. J.
Right arrow Articles by Yacoub, M. H.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Medline Plus Health Information
*Heart Failure
*Heart Transplantation
*Organ Donation
Related Collections
Right arrow Other myocardial biology
Right arrow Other heart failure
Right arrow Apoptosis
Right arrow Gene expression
Right arrow Growth factors/cytokines
Right arrow Heart failure - basic studies
Right arrow Echocardiography
Right arrow CV surgery: transplantation, ventricular assistance, cardiomyopathy
Right arrow Acute Cerebral Hemorrhage
Right arrow Autonomic, reflex, and neurohumoral control of circulation