(Circulation. 2000;102:326.)
© 2000 American Heart Association, Inc.
Clinical Investigation and Reports |
Tumor Necrosis Factor-
Is Expressed in Donor Heart and Predicts Right Ventricular Failure After Human Heart Transplantation
From the National Heart and Lung Institute at the Imperial College School of Medicine, Royal Brompton and Harefield Hospital, Harefield, Middlesex, UK (E.J.B., V.J.O., P.B.J.B., N.R.B., A.K., M.H.Y.), and the Department of Histochemistry, Hammersmith Hospital at the Imperial College School of Medicine, London, UK (A.E.B., J.M.P.).
Correspondence to Magdi Yacoub, FRS, Professor of Cardiothoracic Surgery, Heart Science Centre, Royal Brompton and Harefield Hospital, Harefield, Middlesex UB9 6JH, United Kingdom.
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
Background—Myocardial failure is an important problem after heart transplantation. Right ventricular (RV) failure is most common, although its mechanisms remain poorly understood. Inflammatory cytokines play an important role in heart failure. We studied the expression of tumor necrosis factor (TNF)-
and other cytokines in donor
myocardium and their relationship to the subsequent
development of RV failure early after transplantation.
Methods and Results—Clinical details were obtained, and
ventricular function was assessed by
transesophageal echocardiography in
26 donors before heart retrieval. A donor RV biopsy was obtained
immediately before transplantation, and each recipient was followed for
the development of RV failure. Reverse transcriptase–polymerase chain
reaction was performed to detect TNF-, interleukin-2,
interferon-
, and inducible nitric oxide synthase expression. Eight
of 26 recipients (30.8%) developed RV failure. Seven of these 8
(87.5%) expressed TNF-, but only 4 of the 18 (22.2%) who did not
develop RV failure expressed TNF- (P<0.005). As a
predictor of RV failure, TNF- mRNA had a sensitivity of 87.5%, a
specificity of 83.3%, a positive predictive value of 70%, and a
negative predictive value of 93.7%. Western blotting demonstrated more
TNF- protein in the myocardium of donor hearts that
developed RV failure (658±60 versus 470±57 optical density units,
P<0.05). Immunocytochemistry localized TNF-
expression to cardiac myocytes. Reverse transcriptase–polymerase chain
reaction detected interferon- in 2 (7.7%), interleukin-2 in 1
(3.8%), and inducible nitric oxide synthase mRNA in 1 (3.8%) of the
26 donor hearts, none of which developed RV failure.
Conclusions—TNF- expression in donor heart cardiac myocytes
seems to predict the development of RV failure in patients early after
heart transplantation.
Key Words: transplantation • myocardium • contractility
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Asignificant number (
20%) of cardiac donors are not
used for transplantation because of poor donor myocardial
function,1 and 30%2 of early deaths after
transplantation reported by the Registry of the International Society
of Heart and Lung Transplantation occur because of myocardial failure.
Right ventricular (RV) dysfunction is most commonly
seen3 in the clinical setting; this is the result of
either elevated pulmonary vascular resistance in the recipient
or donor myocardial dysfunction. Experimental evidence suggests that
the right ventricle is more susceptible to ischemia-reperfusion
injury than the left ventricle.4 Both RV and left
ventricular dysfunction occur after brain death in
potential organ donors. Experimental studies have shown more pronounced
changes in RV function.3 5 6 7 The mechanisms producing RV
dysfunction remain poorly understood.
Patients with chronic heart failure due to a variety of causes have an
elevated expression of the proinflammatory cytokines, including
tumor necrosis factor (TNF)-, both in the serum and
myocardium.8 9 10 11 12 13 14 15 TNF- depresses myocardial
contractile function,15 16 17 either directly or through the
induction of inducible nitric oxide synthase (iNOS). The
proinflammatory cytokines interleukin (IL)-2 and interferon-
(IFN-) can induce TNF- production.18
Therefore, we investigated the relationship between the myocardial
expression of TNF- and other cytokines in the
myocardium of donor hearts and the development of right
heart failure early after transplantation, as well as the possible
mechanisms of its induction and/or action in this setting.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Donors
Donor details are shown in the Table
. Ten were domino hearts (from
patients undergoing heart-lung transplantation) and 16 were hearts from
brain-dead donors. Causes of death were subarachnoid
hemorrhage (n=8), intracranial infarct (n=3), head injury
(n=2), subdural hemorrhage (n=1), asthma (n=1), and meningitis
(n=1). Infection in both the living and brain-dead donors was defined
as a raised white cell count combined with either pyrexia or evidence
of consolidation on a chest x-ray. The protocol was approved by the
Hillingdon Health Authority Ethics Committee.
Transesophageal echocardiograms at the time of
retrieval showed that all the donors had an ejection fraction >55%.
Mean central venous pressure was 8.9±1.0 mm Hg (range, 4 to
16 mm Hg). Preservation of the donor heart was done by the
infusion of St Thomas’ solution at 4°C. Mean ischemia
time was 134±11 minutes (range, 35 to 210 minutes). RV
endomyocardial biopsies were obtained from the
donor heart immediately before implantation and frozen in liquid
nitrogen for analyses with reverse transcriptase–polymerase
chain reaction (RT-PCR) and Western blotting. A further biopsy was
fixed in 10% formal saline for immunocytochemistry.
|
Recipients
The recipients of the donor hearts included 21 men and 5 women
with a mean age 46.8 years (range, 27 to 62 years). Indications for
transplantation were dilated cardiomyopathy (n=13),
ischemic heart disease (n=11), postpartum
cardiomyopathy (n=1), and myocarditis (n=1). New
York Heart Association class before transplantation was III in 19
recipients and IV in 7 recipients. Before transplantation, mean
pulmonary artery pressure was 29.2±2 mm Hg, mean
pulmonary capillary wedge pressure was 20.7±2 mm Hg,
mean transpulmonary gradient was 8.3±1 mm Hg, and
pulmonary vascular resistance ranged from 1 to 8 Wood units
(mean, 3.5±0.6 Wood units).
Development of right heart failure was defined as a dilated, poorly
contracting right ventricle observed by transesophageal
echocardiography in the presence of low cardiac
output syndrome (defined as 2 of the following: urine output <0.5
mL · kg-1 ·
h-1, inotrope [epinephrine or
norepinephrine] requirements of >0.5 µg ·
kg-1 · min-1
necessary to maintain a systolic blood pressure >90
mm Hg, cardiac index <2, and progressive metabolic
acidosis) and in the presence of adequate left atrial filling
pressures.
RT-PCR
RT-PCR was performed for TNF-, IL-2, IFN-, and iNOS on all
donor biopsies.
RNA Extraction and Preparation of cDNA
Total RNA was extracted from donor RV biopsies as described
previously.19 cDNA was prepared by reverse transcription
of 500 ng of total RNA with Moloney murine leukemia virus RT
(Rnase reverse transcriptase) enzyme using oligo
(dT)12–18 as a primer. After transcription at
37°C for 60 minutes, the reaction mixture was denatured at 95°C for
5 minutes, chilled on ice, and stored at -20°C until required for
PCR amplification.
PCR Amplification
cDNA was amplified in a PCR reaction containing 20 µmol/L
each deoxynucleotide triphosphate, 20 pmol/L each primer, 50
mol/L KCl, 10 mmol/L Tris HCl (pH 8.4), 0.1 mg/mL gelatin (Sigma),
and 1 to 1.5 mmol/L MgCl2. A total of 45
amplification cycles with denaturation at 94°C for 30 s,
annealing at 58°C for 30 s, and extension at 72°C were
performed. Products were analyzed by ethidium bromide
staining after gel electrophoresis.
Oligonucleotide primers to TNF-, iNOS, and GAPDH
were designed in-house from published sequences. Sequences for TNF-
were as follows: TNF- sense: CACCACGCTCTTCTGCCTGC (HUMTNFAA 217 to
236) and antisense: TCTCAGCTCCACGCCATT (HUMTNFAA 445 to 426). iNOS and
GAPDH primers have been described previously20 ; they were
as follows: iNOS sense ATTGATCAGAAGCTGTCCC (HUMINOSA 2127 to 2145),
antisense: GTAGATTCTGCCCAGATTTG (HUMINOS 2392 to 2411), GAPDH sense:
TCACCATCTTCCAGGAGCGA (HSGAPDR 281 to 300), and antisense:
TCCTTGGAGGCCATGTGGGC (HSGAPDR 1045 to 1064).
IFN- primers were described previously,21 and IL-2
primers were commercially available (Clontech Laboratories, Inc). All
primers were intron-spanning.
Western Blot Analysis
Total protein extracts were prepared from 18 of the donor
biopsies (in which sufficient tissue was available), 7 of which
developed RV failure, by homogenising myocardial biopsies in lysis
buffer (1% SDS, 1 mmol/L phenylmethylsulfonylfluoride, 10
µg/mL aprotinin, and 10 µg/ml leupeptin). Protein (40 µg per
sample) was loaded onto a 12.5% SDS-polyacrylamide gel. After
electrophoresis, proteins were transferred onto Hybond-C super
nitrocellulose membranes. Membranes were immersed in PBS-Tween 20 and
5% milk protein overnight at 4°C to block nonspecific binding.
Primary TNF- (Santa-Cruz Biotechnology), diluted 1:500 (v/v) in
PBS-Tween 20/5% milk protein, was added to the membranes for 60
minutes. After washing, membranes were subsequently incubated with a
horseradish-peroxidase–conjugated rabbit anti-goat secondary antibody
(DAKO) diluted 1/1000 (v/v) in PBS-Tween 20/35% milk protein for 1
hour. The immunoreactive bands were visualized using Amersham
electrogenerated chemiluminescent reagents, and they were
scanned using Image Analysis 1000 software (Alpha Innotech).
Immunocytochemistry
Immunocytochemistry was performed on formalin-fixed
paraffin-embedded sections from 17 donor hearts (in which sufficient
tissue was available), 6 of which developed RV failure, to localize the
cell type producing TNF-. The avidin-biotin-peroxidase complex
method22 was used. Endogenous peroxidase was
blocked with 0.03% (v/v) hydrogen peroxide in methanol for 20 minutes.
After incubation with normal goat serum (1:30, 30 minutes), sections
were incubated overnight at 4°C with primary rabbit antibodies to
TNF- (Antigenex America Inc), diluted 1:100 (v/v).
Immunoreaction sites were visualized using the appropriate biotinylated
secondary antibodies and the avidin-biotin-peroxidase complex procedure
(Vector Labs). Peroxidase activity was revealed with a solution of
diaminobenzidine as chromogen with 0.2% (v/v) hydrogen peroxide in PBS
to produce a brown reaction product; sections were counterstained
with Harris’ hematoxylin. Controls consisted of the replacement of
primary antibodies with nonimmune rabbit serum. Semiquantitative
analysis was performed using a BH-60 microscope (Olympus). The
degree of TNF- expression was assessed by 2 independent observers
and graded on a scale from 1 to 3 for each cell type in each
biopsy.
Statistics
Variables are expressed as mean±SEM. Fisher’s exact test
using a 2x2 contingency table and Student’s t test were
used for the analysis. The sensitivity, specificity, positive
predictive values, and negative predictive values were calculated using
standard formulae. P<0.05 was considered
significant.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Heart Failure and Patient Outcome
Eight of the 26 patients (30.8%) developed right heart failure after transplantation. These patients had a significantly longer stay in the intensive therapy unit (mean, 4.1±0.7 days) than those who did not develop RV failure (mean, 1.4±0.27 days; P<0.001). Two of these 8 patients (25%) required intra-aortic balloon counterpulsation in the postoperative period, compared with none of the 18 who did not develop RV failure. Patients with RV failure spent a mean of 43.5±5 days in the hospital (including readmissions) in the first 3 postoperative months, compared with 30.2±3 days for those who did not develop RV failure (P<0.05).
TNF- mRNA Expression
RT-PCR showed that 7 of the 8 patients (87.5%) who developed
right heart failure expressed TNF- mRNA compared with 4 of the 18
patients (22.2%) who did not (P<0.005). None of the known
risk factors for the development of RV failure (such as donor age,
preharvesting presence/absence of inotropes, ischemia time, or
recipient transpulmonary gradient) was present in this
group of patients. As a predictor of right heart failure, TNF- had a
sensitivity of 87.5%, a specificity of 83.3%, a positive predictive
value of 70%, and a negative predictive value of 93.7% (Figure 1a). Of the 16 hearts from brain-dead
donors, 7 (43.8%) developed RV failure and 6 of these 7 (85.7%)
expressed TNF- (Figure 1b).
|
Ten of the 26 donor hearts (38.5%) were domino donor hearts; 9 of
these were from cystic fibrosis patients and 1 was from a patient with
primary pulmonary hypertension. Two of the 10 domino hearts
(20%), both from patients with cystic fibrosis, expressed TNF-
mRNA. One of these 2 hearts developed RV failure after transplantation
into a patient with a low transpulmonary gradient. The domino
heart from the patient with primary pulmonary hypertension did
not express TNF- when transplanted into a patient with a high
transpulmonary gradient. The other 7 domino hearts from
patients with cystic fibrosis did not express TNF- and did not
develop RV failure when transplanted into patients with low
transpulmonary gradients. All patients with cystic fibrosis had
extensive chronic inflammatory changes with a large amount of purulent
secretions in both lungs. In addition, 2 patients had evidence of
active infection (pyrexia with growth of Proteus species in
one and pyrexia in the other) at the time their heart was used for
transplantation, but in neither heart was TNF- expressed.
TNF- expression was not affected by donor age, central venous
pressure, period of ventilation, sex, smoking status, use of inotropes,
or ischemia time (P=NS). TNF- was not affected by
the cause of death (TNF- was positive in 3 of the 8 donors with
subarachnoid hemorrhage, 2 of the 3 with intracranial
infarcts, the donor with a head injury, and the donors with subdural
hemorrhage and asthma; it was not expressed in the donor with
meningitis). TNF- was not affected by the presence of donor
infection (P=NS).
TNF- Protein Expression by Western Blotting
Significantly higher TNF- expression existed in the donor
hearts of patients who developed right heart failure (658.9±60 optical
density [OD] units, n=7) compared with those who did not (470.5±57
OD units, n=11; P<0.05) (Figure 2). A strong trend existed for higher
TNF- protein expression in the donors expressing TNF- mRNA
(637.3±71 OD units) compared with those who did not (474.3±61 OD
units, P=0.07).
|
TNF- Expression by Immunocytochemistry
TNF- expression was localized to cardiac myocytes (Figure 3); it was not expressed in vascular
smooth muscle cells and was only occasionally expressed in
endothelial cells (only one biopsy) (Figure 3).
Semiquantitative analysis showed stronger TNF- expression in
the cardiac myocytes of patients developing right heart failure (score,
1.1±0.4 versus 0.6±0.1 arbitrary units) (Figure 3), although
this did not reach statistical significance. A strong trend existed for
higher TNF- protein expression in cardiac myocytes from the donors
who expressed TNF- mRNA (1.1±0.3 versus 0.5±0.1 arbitrary units;
P=0.09).
|
Other Cytokine Expression
RT-PCR detected IFN- in 2 (7.7%), IL-2 in 1 (3.8%), and iNOS
mRNA in 1 (3.8%) of the 26 donor hearts, and none of these hearts
developed RV failure. Only one of the 2 hearts expressing IFN- also
expressed TNF-, and the heart that expressed IL-2 did not express
TNF- mRNA. In the one heart with iNOS expression, no TNF-
expression occurred.
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
This study documented, for the first time, a relationship between both TNF-
mRNA and protein expression in the myocardium
of donor hearts and the development of right heart failure early after
transplantation. Myocardial failure after transplantation remains an
important problem,2 and it probably has a variety of
causes, including the effects of brain death, donor management, and
ischemia-reperfusion during harvesting and implantation. Studies of cardiac function after brain death in experimental animals by Bittner and colleagues3 6 7 have shown that biventricular systolic function and contractility were significantly decreased after brain death. This impairment of function, however, was more prominent in the right than the left ventricle, with RV function decreasing by 35% and left ventricular function by 19%.6 Although several mechanisms have been suggested,23 the cause of the decrease in ventricular function after brain death remains unclear. In an experimental model of ischemia-reperfusion, Mankad and Yacoub4 observed that the right ventricle was relatively more susceptible. In our patients, ischemia time was not different in patients who developed RV failure compared with those who did not, suggesting that a preexisting myocardial factor could be responsible.
In our study, we found a strong correlation between TNF- mRNA and
protein expression in the donor heart and the development of myocardial
failure after transplantation. Immunocytochemistry localized the site
of TNF- expression to the cardiac myocyte in this study (Figure 3
). It has previously been shown that cardiac myocytes can
produce substantial amounts of TNF-.24 A trend existed
for TNF- mRNA expression to correlate with protein expression, both
in myocardial homogenates (Western blotting) and in
myocytes (immunocytochemistry), although this was not statistically
significant.
TNF- is a proinflammatory cytokine15 that is
released locally in response to infection and injury. Previous studies
have shown elevated plasma concentrations of TNF- in patients with
heart failure.8 9 10 11 12 Furthermore, levels of TNF- have
been associated with decreasing patient functional
status,10 11 and a trend has been found between higher
TNF- concentration and impaired survival.10 TNF-
expression has been demonstrated13 14 in the ventricles of
patients with dilated cardiomyopathy, where it was
seen in cardiac myocytes, endothelial cells, and in the
vascular smooth muscle cells of intramyocardial blood vessels. A recent
study25 showed that the unloading of the failing human
heart by the placement of a left ventricular assist device
is associated with a reduction in TNF- expression. The greatest
reduction occurred in patients who recovered cardiac function and were
successfully weaned off the device, suggesting that the putative effect
of the cytokines on myocardial function could be
reversible.
The mechanism of TNF- induction in our patients remains unknown. No
relationship existed between TNF- induction and infection, period of
ventilation, smoking status, use of inotropes in the donor, or
ischemia time. Although TNF- production can be
stimulated by pressure overload,26 no correlation existed
between TNF- expression and the central venous pressure of the donor
before explantation. However, during and immediately after brain death,
extensive changes in loading conditions occur. In our study, the
correlation between TNF- mRNA expression and the development of
right heart failure in the brain-dead donors suggests that TNF-
expression may result from brain death. Others have
found27 that after the induction of brain death in the
rat, TNF- mRNA can be detected in the heart and other
peripheral organs. In that study, IL-1, IL-2, IL-6, and
IFN- mRNA were also detected. No relationship existed between
TNF- expression and the cause of brain death in our study. TNF-
is likely to be upregulated very quickly in cardiac myocytes after
brain death because it is an "acute phase reactant." This is
analogous to the clinical situation of cardiopulmonary bypass
in which TNF expression has also been observed.28
TNF- production can be induced by the proinflammatory
cytokines IL-2 and IFN-.18 IL-2 was only
detected in one donor in our series and that heart did not express
TNF-, and IFN- was only detected in 2 donor hearts, one of which
expressed TNF-. This suggests that the expression of IL-2 and
IFN- is not the mechanism through which TNF- is produced in our
patients.
Bozkurt et al16 and Yokoyama et al17 showed
that TNF- can depress myocardial function. The
hemodynamic effects of TNF- are characterized by
decreased myocardial contractile efficiency and reduced ejection
fraction, hypotension, and biventricular
dilatation.15 TNF- may affect graft myocardial function
through NO-dependent or NO-independent mechanisms. TNF- can induce
the expression of iNOS,20 29 which can result in the
production of large quantities of NO.8 NO may have
a negative inotropic effect.8 30 We found iNOS expression
in only one donor heart, and this donor did not express TNF-; this
suggests that in the donor heart, TNF- is acting through a
NO-independent mechanism. TNF- binds to 2 receptors, TNFR1 and
TNFR2. Binding to TNFR1 results in sphingosine production,
which decreases calcium transients and may lead to dysfunctional
excitation-contraction coupling and to systolic and/or
diastolic dysfunction.15 31 TNF- can also
induce the apoptosis of cardiac myocytes through a
sphingosine-dependant mechanism.32 Furthermore, TNF-
causes a concentration-dependant increase in the inhibitory
G protein Gi33 in rat cardiac myocytes, and our group
have previously demonstrated increased activity of Gi in donor
hearts with myocardial dysfunction.23 In addition, TNF-
has the potential to lead to heart failure through its effects on
matrix metalloproteinases.34
The patients in our series who developed right heart failure had longer stays in the intensive therapy unit and spent more time in the hospital during the first 3 months after transplantation, which suggests that donor myocardial dysfunction affects patient outcome (as others have shown previously2 35 ) and increases the cost of patient care.
Modulation of TNF- expression might avoid right heart failure in
some recipients and could improve the function of "marginal"
donors, which might lead to an expansion of the useable donor pool.
Etanercept is a p75 TNF receptor fusion protein that binds to TNF-,
thus functionally inactivating it. When given to patients with New York
Heart Association class III heart failure in a randomized double-blind
trial, it increased their quality of life, 6-minute walk distances, and
ejection fractions.36 Pentoxifylline is a xanthine
derivative that suppresses or reduces the production of
TNF-37 and is thought to act at the mRNA
level.38 Administration of pentoxifylline to patients with
idiopathic dilated cardiomyopathy39
resulted in improved functional class, increased ejection fraction, and
decreased TNF- levels. When administered in an animal
model40 of lung transplantation, pentoxifylline improved
oxygen tension, pulmonary vascular resistance, and recipient
survival.
Limitations
Although we demonstrated the expression of TNF- in the right
ventricle, we have no data relating to its expression in the left
ventricle. Although there are plausible biological mechanisms by which
TNF- expression may lead to ventricular dysfunction, our
study cannot prove that TNF- is the only mechanism causing RV
failure in these patients.
Conclusions
Our results suggest that TNF- expression in the donor heart is
an important predictor of the development of right heart failure early
after transplantation and that TNF- may contribute to myocardial
dysfunction. Our results indicate that TNF- does not act through an
NO-dependant mechanism but may act through other pathways.
Pharmacological modulation of TNF- expression in organ donors may be
a useful strategy for reducing post-transplant ventricular
dysfunction.
|
Acknowledgments |
|---|
We would like to thank Mahrokh Nohadani for her invaluable technical help. We would also like to thank the British Heart Foundation for their support (Project Grant Number 96152).
Received October 26, 1999; revision received February 11, 2000; accepted February 14, 2000.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
1. Emery RW, Cork RC, Levinson MM, et al. The cardiac donor: a six year experience. Ann Thorac Surg. 1986;41:356–362.[Abstract]
2. Hosenpud JD, Bennett LE, Berkeley MK, et al. The registry of the International Society for Heart and Lung Transplantation: fifteenth official report-1998. J Heart Lung Transplant. 1998;17:656–668.[Medline] [Order article via Infotrieve]
3.
Bittner HR, Kendall SWH, Chen EP, et al. Myocardial
performance after graft preservation and subsequent cardiac
transplantation from brain-dead donors. Ann Thorac Surg. 1995;60:47–54.
4.
Mankad P, Yacoub M. Influence of basal release of
nitric oxide on systolic and diastolic function of
both ventricles. J Thorac Cardiovasc Surg. 1997;113:770–776.
5. Bizouarn P, Treilhaud M, Portier D, et al. Right ventricular function early after total or standard orthotopic heart transplantation. Ann Thorac Surg. 1994;57:183–187.[Abstract]
6. Bittner HB, Kendall SWH, Chen EP, et al. The combined effects of brain death and cardiac graft preservation on cardiopulmonary hemodynamics and function before and after subsequent heart transplantation. J Heart Lung Transplant. 1996;15:764–767.[Medline] [Order article via Infotrieve]
7. Bittner HB, Chen EP, Craig D, et al. Preload-recruitable stroke work relationships and diastolic dysfunction in the brain-dead organ donor. Circulation. 1996;94{suppl II}:II-320–II-325.
8. Birks EJ, Yacoub MH. The role of nitric oxide and cytokines in heart failure. Coron Artery Dis. 1997;8:389–402.[Medline] [Order article via Infotrieve]
9. Levine B, Kalman J, Mayer L, et al. Elevated circulating levels of tumor necrosis factor in severe chronic heart failure. N Engl J Med. 1990;323:236–241.[Abstract]
10. Torre-Amione G, Kapiada S, Benedict C, et al. Proinflammatory cytokine levels in patients with depressed left ventricular ejection fraction: a report from the studies of left ventricular dysfunction (SOLVD). J Am Coll Cardiol. 1996;27:1201–1206.[Abstract]
11.
Lommi J, Pulkki P, Koskinen P, et al.
Hemodynamic, neuroendocrine and metabolic
correlates of circulating cytokine concentrations in congestive
heart failure. Eur Heart J. 1997;18:1620–1625.
12.
Matsumori A, Yamada T, Suzuki H, et al. Increased
circulating cytokines in patients with myocarditis and
cardiomyopathy. Br Heart J. 1994;72:561–566.
13.
Satoh M, Nakamura M, Saitoh H, et al. Tumor necrosis
factor--converting enzyme and tumor necrosis factor- in
human dilated cardiomyopathy.
Circulation. 1999;99:3260–3265.
14. Habib FM, Springall DR, Davies GJ, et al. Tumor necrosis factor and inducible nitric oxide synthase in dilated cardiomyopathy. Lancet. 1996;347:1151–1155.[Medline] [Order article via Infotrieve]
15. Meldrum DR. Tumor necrosis factor in the heart. Am J Physiol. 1998;274:R577–R595.
16.
Bozkurt B, Kribbs SB, Clubb FJ, et al.
Pathophysiologically relevant concentrations of
tumor necrosis factor- promote left ventricular
dysfunction and remodeling in rats. Circulation. 1998;97:1382–1391.
17. Yokoyama T, Vaca L, Rossen RD, et al. Cellular basis for the negative inotropic effects of tumor necrosis factor-alpha in the adult mammalian heart. J Clin Invest. 1993;92:2303–2312.
18. Smith CA, Farrah T, Goodwin RG. The TNF receptor superfamily of cellular and viral proteins: activation, costimulation and death. Cell. 1994;76:959–962.[Medline] [Order article via Infotrieve]
19. Chomczynski P, Sacci, N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987;162:156–159.[Medline] [Order article via Infotrieve]
20.
Chester AHY, Borland JAA, Buttery LDK, et al. Induction
of nitric oxide synthase in human vascular smooth muscle: interactions
between pro-inflammatory cytokines. Cardiovasc Res. 1998;38:814–821.
21. Bishop GA, Rokahr KL, Napoli J, et al. Intragraft cytokine mRNA levels in human liver allograft rejection analyzed by reverse transcription and semiquantitative polymerase chain reaction amplification. Transplant Immunol. 1993;1:253–261.[Medline] [Order article via Infotrieve]
22. Hsu SM, Raine L, Fanger H. Use of avidin-biotin-peroxidase complex (ABC) in immunoperoxidase techniques: a comparison between ABC and unlabeled antibody (PAP) procedures. J Histochem Cytochem. 1981;29:577–580.[Abstract]
23.
Owen VJ, Burton P, Michel MC, et al. Myocardial
dysfunction in donor hearts: a possible etiology.
Circulation. 1999;99:2565–2570.
24. Kapadia S, Lee J, Torre-Amione G, et al. Tumor necrosis factor-alpha gene and protein expression in adult feline myocardium after endotoxin administration. J Clin Invest. 1995;96:1042–1052.
25.
Torre-Amione G, Stetson SJ, Youker KA, et al. Decreased
expression of tumor necrosis factor- in failing human
myocardium after mechanical circulatory support: a
potential mechanism for cardiac recovery. Circulation. 1999;100:1189–1193.
26.
Kapadia S, Oral H, Lee J, et al.
Hemodynamic regulation of tumor necrosis
factor- gene and protein expression in adult feline
myocardium. Circ Res. 1997;81:187–195.
27. Takada M, Nadeau KC, Hancock WW, et al. Effects of explosive brain death on cytokine activation of peripheral organs in the rat. Transplantation. 1998;65:1533–1542.[Medline] [Order article via Infotrieve]
28. Menasche P. Inflammatory response to bypass and its impact on postoperative myocardial function. In: Yacoub MH, Carpentier AF, eds. Annual of Cardiac Surgery. 9th ed. London: Rapid Science Publishers; 1996:53–61.
29.
Balligand J-L, Ungureanu-Longrois D, Simmons WW, et al.
Cytokine-inducible nitric oxide synthase (iNOS) expression in
cardiac myocytes: characterisation and regulation of iNOS expression
and detection of iNOS activity in single cardiac myocytes in
vitro. J Biol Chem. 1994;269:27580–27588.
30. Shulz R, Panas DL, Catena R, et al. The role of nitric oxide in cardiac depression induced by interleukin-1ß and tumor necrosis factor-alpha. Br J Pharmacol. 1995;114:27–34.[Medline] [Order article via Infotrieve]
31.
Oral H, Dorn GW, Mann DL. Sphingosine mediates the
immediate negative inotropic effects of tumor necrosis factor-
in the adult mammalian cardiac myocyte. J Biol Chem. 1997;272:4836–4842.
32. Krown KA, Page MT, Nguyen C, et al. Tumor necrosis factor alpha-induced apoptosis in cardiac myocytes: involvement of the sphingolipid signaling cascade in cardiac cell death. J Clin Invest. 1996;98:2854–2865.[Medline] [Order article via Infotrieve]
33.
Reithmann C, Glerschick P, Werdan K, et al. Tumor
necrosis factor- up-regulates Gi alpha and G beta proteins and
adenyl cyclase responsiveness in rat cardiomyocytes.
Eur J Pharmacol. 1991;206:53–60.[Medline]
[Order article via Infotrieve]
34.
Mann DL, Spinale FG. Activation of matrix
metalloproteinases in the failing human heart: breaking the tie that
binds. Circulation. 1998;98:1699–1702.
35. Darracott-Cancovic S, Stovin PGI, Wheeldon D, et al. Effect of donor heart damage on survival after transplantation. Eur J Cardiothorac Surg. 1989;3:525–532.[Abstract]
36.
Deswal A, Bozkurt B, Seta Y, et al. Safety and efficacy
of a soluble P75 tumor necrosis factor receptor (Enbrel, Etanercept) in
patients with advanced heart failure. Circulation. 1999;99:3224–3226.
37. Waage A, Sorensen M, Stordal B. Differential effect of pentoxifylline on tumor necrosis factor and interleukin-6 production. Lancet. 1990;335:543.[Medline] [Order article via Infotrieve]
38. Kremsner PG, Grundmann H, Neifer S, et al. Pentoxifylline prevents murine cerebral malaria. J Infect Dis. 1991;164:605–608.[Medline] [Order article via Infotrieve]
39. Sliwa K, Skudicky D, Candy G, et al. Randomised investigation of effects of pentoxifylline on left-ventricular performance in idiopathic dilated cardiomyopathy. Lancet. 1998;351:1091–1093.[Medline] [Order article via Infotrieve]
40.
Murakami S, Bacha EA, Herve P, et al. Inhaled nitric
oxide and pentoxifylline in rat lung transplantation from non-heart
beating donors. J Thorac Cardiovasc Surg. 1997;113:821–829.
This article has been cited by other articles:
 |
|
 |
|
  S. Aharinejad, O. Andrukhova, M. Gmeiner, A. Thomas, A. Aliabadi, A. Zuckermann, K. Krenn, and M. Grimm Donor Serum SMARCAL1 Concentrations Predict Primary Graft Dysfunction in Cardiac Transplantation Circulation, September 15, 2009; 120(11_suppl_1): S198 - S205. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. V. Venkateswaran, J. S. Ganesh, J. Thekkudan, R. Steeds, I. C. Wilson, J. Mascaro, R. Thompson, and R. S. Bonser Donor cardiac troponin-I: a biochemical surrogate of heart function Eur. J. Cardiothorac. Surg., August 1, 2009; 36(2): 286 - 292. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. D. McCully, M. K. Bhasin, C. Daly, M. C. Guerrero, S. Dillon, T. A. Liberman, D. B. Cowan, J. D. Mably, F. X. McGowan, and S. Levitsky Transcriptomic and proteomic analysis of global ischemia and cardioprotection in the rabbit heart Physiol Genomics, July 9, 2009; 38(2): 125 - 137. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. M. Osipov, C. Bianchi, R. T. Clements, J. Feng, Y. Liu, S.-H. Xu, M. P. Robich, J. Wagstaff, and F. W. Sellke Thrombin Fragment (TP508) Decreases Myocardial Infarction and Apoptosis After Ischemia Reperfusion Injury. Ann. Thorac. Surg., March 1, 2009; 87(3): 786 - 793. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. D. McCully, D. B. Cowan, C. A. Pacak, I. K. Toumpoulis, H. Dayalan, and S. Levitsky Injection of isolated mitochondria during early reperfusion for cardioprotection Am J Physiol Heart Circ Physiol, January 1, 2009; 296(1): H94 - H105. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Bak, I. Lekli, B. Juhasz, N. Nagy, E. Varga, J. Varadi, R. Gesztelyi, G. Szabo, L. Szendrei, I. Bacskay, et al. Cardioprotective mechanisms of Prunus cerasus (sour cherry) seed extract against ischemia-reperfusion-induced damage in isolated rat hearts Am J Physiol Heart Circ Physiol, September 1, 2006; 291(3): H1329 - H1336. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Odeh, E. Sabo, and A. Oliven Circulating levels of tumor necrosis factor-{alpha} correlate positively with severity of peripheral oedema in patients with right heart failure Eur J Heart Fail, March 1, 2006; 8(2): 141 - 146. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. C. Stoica, D. K. Satchithananda, C. Atkinson, S. Charman, M. Goddard, and S. R. Large Heat shock protein, inducible nitric oxide synthase and apoptotic markers in the acute phase of human cardiac transplantation Eur. J. Cardiothorac. Surg., December 1, 2003; 24(6): 932 - 939. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. N. Chan, P. Vallance, and H. M. Colhoun Endothelium-Dependent and -Independent Vascular Dysfunction in Type 1 Diabetes: Role of Conventional Risk Factors, Sex, and Glycemic Control Arterioscler Thromb Vasc Biol, June 1, 2003; 23(6): 1048 - 1054. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Eikmans, H. J. Baelde, E. C. Hagen, L. C. Paul, P. H. C. Eilers, E. de Heer, and J. A. Bruijn Renal mRNA Levels as Prognostic Tools in Kidney Diseases J. Am. Soc. Nephrol., April 1, 2003; 14(4): 899 - 907. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. L. Brutsaert Cardiac Endothelial-Myocardial Signaling: Its Role in Cardiac Growth, Contractile Performance, and Rhythmicity Physiol Rev, January 1, 2003; 83(1): 59 - 115. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. K. Koh Effects of estrogen on the vascular wall: vasomotor function and inflammation Cardiovasc Res, September 1, 2002; 55(4): 714 - 726. [Full Text] [PDF]
|
|
|
|
 |
|
 G. Plenz, H. Eschert, M. Erren, T. Wichter, M. Bohm, M. Flesch, H. H. Scheld, and M. C. Deng The interleukin-6/interleukin-6-receptorsystem is activated in donor hearts J. Am. Coll. Cardiol., May 1, 2002; 39(9): 1508 - 1512. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Wakiyama, D. B. Cowan, Y. Toyoda, M. Federman, S. Levitsky, and J. D. McCully Selective opening of mitochondrial ATP-sensitive potassium channels during surgically induced myocardial ischemia decreases necrosis and apoptosis Eur. J. Cardiothorac. Surg., March 1, 2002; 21(3): 424 - 433. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. C. Stoica, M. Goddard, and S. R. Large The endothelium in clinical cardiac transplantation Ann. Thorac. Surg., March 1, 2002; 73(3): 1002 - 1008. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. J. Jarvisalo, T. Ronnemaa, I. Volanen, T. Kaitosaari, K. Kallio, J. J. Hartiala, K. Irjala, J. S. A. Viikari, O. Simell, and O. T. Raitakari Brachial artery dilatation responses in healthy children and adolescents Am J Physiol Heart Circ Physiol, January 1, 2002; 282(1): H87 - H92. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. E. LIGHT, H. D. KANJI, J. E. M. FOX, and R. J. FRENCH Distinct myoprotective roles of cardiac sarcolemmal and mitochondrial KATP channels during metabolic inhibition and recovery FASEB J, December 1, 2001; 15(14): 2586 - 2594. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. O. Iversen, G. Nicolaysen, and M. Sioud DNA enzyme targeting TNF-alpha mRNA improves hemodynamic performance in rats with postinfarction heart failure Am J Physiol Heart Circ Physiol, November 1, 2001; 281(5): H2211 - H2217. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. C. Stoica, D. K. Satchithananda, J. Dunning, and S. R. Large Two-decade analysis of cardiac storage for transplantation Eur. J. Cardiothorac. Surg., October 1, 2001; 20(4): 792 - 798. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. D. Wagner, B. Jonitz, E. V. Potapov, N. Qedra, K. Wegscheider, K. Abraham, E. A. Ivanitskaia, M. Loebe, and R. Hetzer Procalcitonin, A Donor-Specific Predictor of Early Graft Failure-Related Mortality After Heart Transplantation Circulation, September 18, 2001; 104 (2009): I-192 - I-196. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Plenz, Z. F. Song, T. D.T. Tjan, C. Koenig, H. A. Baba, M. Erren, M. Flesch, T. Wichter, H. H. Scheld, and M. C. Deng Activation of the cardiac interleukin-6 system in advanced heart failure Eur J Heart Fail, August 1, 2001; 3(4): 415 - 421. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Toyoda, I. Friehs, R. A. Parker, S. Levitsky, and J. D. McCully Differential role of sarcolemmal and mitochondrial KATP channels in adenosine-enhanced ischemic preconditioning Am J Physiol Heart Circ Physiol, December 1, 2000; 279(6): H2694 - H2703. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||