This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Marra, D. E. Articles by Liao, J. K. Search for Related Content PubMed PubMed Citation Articles by Marra, D. E. Articles by Liao, J. K. Pubmed/NCBI databases Compound via MeSH Substance via MeSH Hazardous Substances DB ACETYLSALICYLIC ACID INDOMETHACIN Related Collections Smooth muscle proliferation and differentiation

(Circulation. 2000;102:2124.)
© 2000 American Heart Association, Inc.

Basic Science Reports

Inhibition of Vascular Smooth Muscle Cell Proliferation by Sodium Salicylate Mediated by Upregulation of p21^Waf1 and p27^Kip1

Diego E. Marra, BA; Tommaso Simoncini, MD; James K. Liao, MD

From the Cardiovascular Division, Brigham & Women’s Hospital and Harvard Medical School, Boston, Mass.

Correspondence to James K. Liao, MD, Cardiovascular Division, 221 Longwood Ave, LMRC-322, Boston, MA 02115. E-mail jliao{at}rics.bwh.harvard.edu

	Abstract

Top Abstract Introduction Methods Results Discussion References

 
Background—Salicylates may have direct vascular effects by mechanisms that are independent of platelet inhibition.

Methods and Results—We investigated the effect of salicylates on vascular smooth muscle cell (SMC) proliferation in response to platelet-derived growth factor (PDGF) in vitro. Salicylate concentrations of 5 and 10 mmol/L inhibited serum- or PDGF-induced SMC cell count and [³H]thymidine incorporation by 62% and 81%, respectively. There was no evidence of cellular toxicity or apoptosis as determined by trypan blue exclusion and FACS analyses. Because cell cycle progression is regulated by hyperphosphorylation of the retinoblastoma (Rb) protein, we examined the effects of salicylate on Rb hyperphosphorylation. Treatment with salicylate, but not indomethacin, inhibited nuclear factor-B activation and completely abolished Rb hyperphosphorylation in PDGF-treated SMCs. This effect was associated with a decrease in cyclin-dependent kinase (Cdk)-2 and, to a lesser extent, Cdk-6, but not Cdk-4 activity, without changes in Cdk-2, -4, and -6 and cyclin D and E protein levels. Because Cdk-2 activity is regulated by the Cdk inhibitors p21^Waf1 and p27^Kip1, we studied the effects of salicylate on p21^Waf1 and p27^Kip1 expression. Treatment with salicylate prevented PDGF-induced downregulation of p21^Waf1 and p27^Kip1 but not of the Cdk-4/-6 inhibitor p16^Ink4.

Conclusions—These findings indicate that high doses of salicylates inhibit SMC proliferation by cell cycle arrest at the G₁-S phase and suggest a beneficial role for high-dose salicylates in the treatment of vascular proliferative disorders.

Key Words: aspirin • cells • muscle, smooth • proteins • kinases

	Introduction

Top Abstract Introduction Methods Results Discussion References

 
The proliferation of vascular smooth muscle cells (SMCs) is a central event in the pathogenesis of vascular lesions, including postangioplasty restenosis, transplant arteriosclerosis, and vein graft occlusion.¹ Cellular proliferation is governed by the eukaryotic cell cycle,² which comprises 4 distinct sequential phases (G₀, G₁, S, and G₂).³ This tightly controlled temporal order is imposed by the sequential activation of a number of serine/threonine protein kinases known as cyclin-dependent kinases (Cdks),⁴ which hyperphosphorylate the retinoblastoma protein (Rb).³

In quiescent cells, Rb is present in a hypophosphorylated state that enables it to bind to and sequester members of the E2F family of transcription factors.⁵ Phosphorylation of Rb at multiple sites induces a conformational change that releases E2F, enabling E2F to activate the transcription of genes required for further cell cycle progression, including those for thymidine kinase, dihydrofolate reductase, cdc2, and cyclin A.^{6 7} The activity of cyclin-Cdk complexes is, in turn, negatively regulated by a number of Cdk inhibitors.⁸ The known Cdk inhibitors can be grouped into 2 distinct families: members of the INK4 family, which includes p16^INK4a, p15^INK4b, p18^INK4c, and p19^INK4d (see References 9 through 12^{9 10 11 12} ), are specific inhibitors of Cdk-4 and Cdk-6,^{9 12} whereas p21^waf1/p27^kip1 family members block cell cycle progression by inhibiting cyclin D–, E–, and A–associated Cdk complexes.¹³

Recent studies suggest that salicylates, when administered at high doses (ie, >1 mmol/L), can exert direct antiproliferative effects. Aspirin and salicylate, in doses ranging between 1 and 10 mmol/L, inhibit cell growth, DNA and protein synthesis, and G₁ to S progression in rat glioma and human colon adenocarcinoma cell lines.^{14 15} Furthermore, high doses of lysinmono(acetylsalicylate), a buffered soluble salt of acetylsalicylic acid, have been shown to prevent SMC proliferation in response to 5% to 10% serum.¹⁶ However, the mechanism for this growth-inhibitory effect has not been demonstrated.¹⁶ Thus, the purpose of this study was to determine the mechanism by which high-dose salicylates regulate cell cycle progression in human SMCs.

	Methods

Top Abstract Introduction Methods Results Discussion References

 
Reagents
DMEM, penicillin, streptomycin, and trypsin were obtained from BioWhittaker. FCS was purchased from Gibco. Sodium salicylate, acetylsalicylic acid, and indomethacin were purchased from Sigma Chemical Corp. PDGF-BB was purchased from Genzyme. [-³²P]ATP and [³H]thymidine were supplied by New England Nuclear. The antibody detection kit (enhanced chemiluminescence) and protein (polyvinylidine difluoride) transfer membranes were purchased from Amersham Corp.

Cell Culture
Human vascular SMCs were isolated from human saphenous veins as described.¹⁷ The cells were characterized by phase-contrast microscopy and staining for SMC-specific -actin. Cell numbers were determined with a Neubauer chamber hemocytometer, with quadruplicate counts performed for each treatment condition. Cell viability was assessed by trypan blue exclusion as described.¹⁸

Flow Cytometry
Cellular DNA content and the presence of hypodiploid (apoptotic) cells were assessed by flow cytometry as described.¹⁹ The percentage of cells with decreased DNA staining (A₀), composed of apoptotic cells resulting from either fragmentation or decreased chromatin, of 10 000 cells per experimental condition was counted. As a positive control for apoptosis, SMCs were treated with manumycin A, a known activator of the apoptotic process.¹⁹ Cell debris was excluded from analysis by selective gating based on anterior and right angle scatter.

[³H]Thymidine Incorporation
DNA synthesis was assessed by the level of [³H]thymidine incorporation. Cells were seeded in 24-well plates and cultured in growth medium to 80% confluence. They were then washed twice and incubated in DMEM containing 0.4% FCS for 48 hours for synchronization in G₀. Cells were preincubated with the indicated agents for 1 hour. The medium was then replaced with growth medium containing 4 ng/mL PDGF, and the indicated reagents were simultaneously re-added. After 24 hours, [³H]thymidine (10 µCi/mL) was added, and the cells were incubated an additional 24 hours. Incorporated radioactivity in cell lysates was determined with a liquid scintillation counter (Beckman LS 6000IC).

Western Blotting
Quiescent cultures of primary smooth muscle cells were treated as indicated, and immunoblotting was performed as described.¹⁸ Immunoblotting was performed with monoclonal or polyclonal antibodies against Rb (14001A), p21^Waf1 (65951A) (Pharmingen, 1.5 µg/mL), p16^Ink4 (F-12), p27^Kip1 (C-19), p53 (DO-1), cyclin A (BF-683), cyclin D (R-124), cyclin E (M-20), Cdk-2 (M-2), Cdk-4 (H-22), and Cdk-6 (C-21) (Santa Cruz Biotechnology, 1 µg/mL).

Cyclin-Dependent and IB Kinase Assay
Cyclin-dependent kinase and IB kinase complex (IKK) activities were measured as described.¹⁸ Cdk-2, -4, and -6 were immunoprecipitated from 300 mg of total cellular lysates with 3 µg of the corresponding human Cdk-specific antibody (Santa Cruz, M-2, H-22, and C-21, respectively) for 1 hour at 4°C. IKK- and IKK-ß were immunoprecipitated by an IKK-specific antibody that recognizes both isoforms (Santa Cruz). The purified enzymes were then incubated with either full-length GST-pRb or GST–IB- fusion protein (2 µg, Santa Cruz) as the substrate in 15 µL kinase buffer (mmol/L: Cdk-2 and IB-: Tris 50 [pH 7.6], MgCl₂ 10, DTT 1; Cdk-4 and Cdk-6: HEPES 50 [pH 7.5], MgCl₂ 10, DTT 1) containing ATP (10 µmol/L), 3 mCi of [-³²P]ATP, ß-glycerophosphate (10 mmol/L), NaF (10 mmol/L), p-nitrophenylphosphate (10 mmol/L), Na₃VO₄ (300 µmol/L), benzamidine (1 mmol/L), PMSF (2 µmol/L), aprotinin (10 µg/mL), leupeptin (1 µg/mL), pepstatin (1 µg/mL), and DTT (1 mmol/L) at 30°C for 45 minutes. The reaction was terminated by addition of an equal volume of loading buffer and boiling for 5 minutes. Proteins were separated on 12% SDS-PAGE, and autoradiography of the dried gel was performed at -80°C. As a control for nonspecific phosphorylation, the IB- mutant (32,36: ST) was used as substrate.

Electrophoretic Mobility Shift Assay
Nuclear extracts were prepared and electrophoretic mobility shift assays were performed as described.¹⁸ The nuclear factor (NF)-B oligonucleotide used corresponded to the palindromic NF-B consensus sequence: AGTTGAGGGGACTTTCCCAGG (Santa Cruz). The mutant B oligonucleotide contained the following sequence: AGTTGATTTGACTTTAACAGG.

Data Analysis
Band intensities from Western blots, electrophoretic mobility shift assay, and kinase assays were quantified by densitometry with the National Institutes of Health Image program. All values are expressed as mean±SD compared with controls and among separate experiments. For statistical significance, paired and unpaired Student’s t tests were used. For comparison between multiple groups, data were analyzed by ANOVA. A significant difference was taken for P<0.05.

	Results

Top Abstract Introduction Methods Results Discussion References

 
Effect of Salicylate on SMC Proliferation
SMCs incubated in growth medium alone grew exponentially through day 10, plateauing on day 12 (Figure 1). In a concentration-dependent manner, addition of salicylate to the medium inhibited SMC proliferation. Although 0.1 mmol/L salicylate did not affect cell number compared with controls, 1 mmol/L salicylate led to a reduction in SMC growth beginning at day 4 and resulting in a 33±4% growth inhibition at day 10 (P<0.01). Treatment with 5 mmol/L salicylate completely inhibited SMC proliferation over the course of the experiment (P<0.01 compared with controls).

View larger version (17K): [in this window] [in a new window]   Figure 1. Effect of salicylate on SMC proliferation. A, Subconfluent quiescent SMCs were cultured in growth medium (10% FCS) alone or in presence of salicylate (Sal, 0.1 to 5 mmol/L). B, SMCs were cultured in growth medium alone or in presence of salicylate (Sal, 5 mmol/L). On day 4 (arrow), cells were washed and medium was replaced with salicylate-free growth medium.

To assess the reversibility of this growth-inhibitory effect, cells incubated in the presence of 5 mmol/L salicylate were washed on day 4, and the medium was replaced with salicylate-free growth medium. As shown in Figure 1B, removal of salicylate from the medium led SMCs to re-enter the growth phase at a rate comparable to that of controls.

Effect of Salicylate on Cell Viability
Salicylate (1 to 5 mmol/L) did not significantly affect SMC viability compared with controls over the first 6 days of treatment (Figure 2A). Even at day 9, when a statistically significant difference between salicylate (5 mmol/L) and controls could be detected, the proportion of salicylate-treated cells showing positive dye uptake was not greater than 7%. Morphologically, salicylate-treated cells did not show any features suggestive of cytotoxicity, such as retraction, rounding, or detachment (data not shown). Furthermore, salicylate (1 to 5 mmol/L) did not increase the proportion of floating cells compared with controls. These results are consistent with the ability of salicylate-treated SMCs to resume growth after removal of the compound from the medium (Figure 1B).

View larger version (10K): [in this window] [in a new window]   Figure 2. Effect of salicylate on SMC viability and apoptosis. A, SMCs were cultured in growth medium with and without salicylate (1 to 5 mmol/L). Cell viability was assessed at indicated time points by trypan blue exclusion. Detergent saponin (Sap, 0.1%) was used as positive control. *P<0.05 vs growth medium alone. B, SMCs were stimulated with growth medium (10% FCS) in presence or absence of salicylate (5 and 10 mmol/L) for 24 hours. All cells were subjected to FACS analyses of DNA content. Percentage of apoptotic cells (A0) is indicated above bar encompassing sub-G1 region. Experiments were performed 3 times with similar results. Man A indicates manumycin A.

Effect of Salicylate on SMC Apoptosis
To assess the contribution of apoptosis to a decrease in SMC proliferation, we performed flow cytometry and DNA electrophoresis to evaluate the effect of salicylate on SMC apoptosis. For these experiments, exponentially growing subconfluent SMCs were exposed to salicylate (1 to 10 mmol/L) in growth medium for 24 hours. Evaluation of all SMCs by flow cytometry did not show features of apoptosis. The percentage of hypodiploid cells having a reduced DNA content (ie, sub-G₁ or A₀) did not exceed 0.5%, even at the highest treatment concentrations (Figure 2B). Similarly, treatment of exponentially growing SMCs with salicylate (1 to 10 mmol/L) did not show degradation of genomic DNA to oligonucleosomal bands, a characteristic marker of apoptosis²⁰ (data not shown). In contrast, treatment with manumycin A (50 µmol/L), a known stimulus for SMC apoptosis,¹⁹ induced substantial DNA fragmentation.

Effect of Salicylate on DNA Synthesis
Compared with untreated controls, salicylate (1 to 10 mmol/L) inhibited PDGF-induced SMC DNA synthesis as assessed by [³H]thymidine incorporation (Figure 3A). Whereas no significant difference was observed with 0.1 mmol/L of salicylate, 1 mmol/L of salicylate inhibited thymidine incorporation by 12±2% (P<0.01), and concentrations of 5 mmol/L resulted in >70% inhibition (P<0.005). The calculated IC₅₀ value for salicylate-mediated inhibition of SMC proliferation was 2.4±0.5 mmol/L. This inhibition was apparent as soon as SMC DNA synthesis was detectable (18 hours after stimulation) and persisted over 96 hours of treatment (data not shown). Taken together, these data suggest that salicylate inhibited cell cycle progression during G₁ or at the G₁-S transition.

View larger version (23K): [in this window] [in a new window]   Figure 3. Effect of salicylate on DNA synthesis and Rb hyperphosphorylation. A, Subconfluent SMCs were synchronized in G0 by incubation in serum-deficient medium for 48 hours before addition of PDGF (4 ng/mL) in 10% FCS and [3H]thymidine in presence or absence of salicylate (Sal, 0.1 to 10 mmol/L). *P<0.01 and **P<0.001 vs growth medium alone. B, Time-dependent (Sal, 5 mmol/L, 0 to 36 hours) and C, concentration-dependent (Sal, 1 to 10 mmol/L, 24 hours) effect of salicylate on PDGF-induced Rb phosphorylation in SMCs. Hypophosphorylated (pRb) and hyperphosphorylated (ppRb) states of Rb are indicated by arrows. Experiments were performed 3 times with similar results.

Effect of Salicylate on Hyperphosphorylation of Rb Protein
In quiescent cells, most of the Rb protein was present in the hypophosphorylated state (Figure 3B). Addition of PDGF resulted in a prominent induction of phosphorylation, beginning at 18 hours and reaching a plateau after 24 hours. As with DNA synthesis, Rb phosphorylation was dose-dependently inhibited by salicylate (Figure 3C). As calculated from densitometric measurements, doses of 1, 2, 5, and 10 mmol/L salicylate led to 10±5%, 38±7%, 73±1%, and 77±1% inhibition of Rb hyperphosphorylation compared with PDGF-stimulated controls. Doses >5 mmol/L resulted in complete suppression of Rb phosphorylation, yielding densitometric measurements equivalent to those of quiescent controls. As with DNA synthesis, the calculated IC₅₀ value of salicylate was in the 2 to 3 mmol/L range.

Effect of Acetylsalicylic Acid and Indomethacin on SMC Cell Cycle
To determine whether the antiproliferative effect of salicylate is similar to that of acetylsalicylic acid (ASA) and mediated by inhibition of cyclooxygenase, we treated quiescent SMCs with growth medium in the presence of ASA or indomethacin. In a concentration-dependent manner, ASA inhibited SMC DNA synthesis and Rb hyperphosphorylation with an IC₅₀ value equivalent to that of salicylate. (Figure 4A and 4B). In contrast, high doses of indomethacin (50 to 250 µmol/L), an inhibitor of cyclooxygenase, did not suppress thymidine incorporation or Rb hyperphosphorylation (Figure 5A and 5B). Indeed, we observed a small but significant increase in SMC DNA synthesis with indomethacin treatment (18±12% over control, P<0.05).

View larger version (22K): [in this window] [in a new window]   Figure 4. Effect of aspirin (ASA) on SMC DNA synthesis and Rb hyperphosphorylation. A, [3H]thymidine incorporation was measured in PDGF (4 ng/mL)–stimulated SMCs in presence or absence of ASA (0.5 to 10 mmol/L) at 24 hours. B, Immunoblot showing effect of ASA (0.5 to 10 mmol/L) on PDGF-induced Rb phosphorylation at 24 hours. *P<0.01 and **P<0.005 vs PDGF alone. Experiments were performed 3 times with similar results.

View larger version (24K): [in this window] [in a new window]   Figure 5. Effect of indomethacin on SMC DNA synthesis and Rb hyperphosphorylation. A, [3H]thymidine incorporation was measured in PDGF (4 ng/mL)–stimulated SMCs in presence of increasing concentrations of indomethacin (Indo), salicylate (Sal, 5 mmol/L), and aspirin (ASA, 5 mmol/L) at 24 hours. B, Effect of salicylate (5 mmol/L), ASA (5 mmol/L), or Indo (50 mmol/L) on PDGF-induced Rb phosphorylation at 24 hours. **P<0.01 vs PDGF alone. Experiments were performed 3 times with similar results.

Effect of Salicylate on Cdks
To study the mechanism underlying the inhibition of Rb phosphorylation by salicylate, we measured the effect of salicylate on Cdk-2, Cdk-4, and Cdk-6 activities. When GST-Rb fusion protein was used as substrate, quiescent SMCs had minimal Cdk-2, -4, and -6 activity (Figure 6A). Treatment with PDGF increased Cdk-2 activity after 24 hours compared with controls. In a concentration-dependent manner, cotreatment with salicylate inhibited PDGF-induced Cdk-2 activity, leading to almost complete suppression at a salicylate concentration of 10 mmol/L. In contrast, the effects of salicylate on the activities of the cyclin D–associated kinases, Cdk-4 and Cdk-6, were much less pronounced than that on Cdk-2. Salicylate did not appreciably inhibit Cdk-4 activity, even at the highest concentration tested (10 mmol/L). Cdk-6 activity was only partially inhibited by salicylate; its activity was 60% to 70% that of PDGF-treated samples, even in the presence of 10 mmol/L salicylate.

View larger version (54K): [in this window] [in a new window]   Figure 6. Effect of salicylate on Cdks and Cdk inhibitors. A, Kinase assays using GST-Rb fusion protein as substrate showing effect of salicylate (Sal, 1 to 10 mmol/L) on PDGF (4 ng/mL)–induced Cdk-2, Cdk-4, and Cdk-6 activity at 24 hours. B, Immunoblots showing time-dependent effect of PDGF (4 ng/mL), salicylate (Sal, 5 mmol/L), or both on cyclin and Cdk protein levels.

To address whether the inhibition of CDK activities by salicylate was associated with a reduction in cyclin and/or Cdk protein levels, we performed immunoblotting on whole-cell lysates from growth-stimulated SMCs incubated in the absence or presence of salicylate (5 mmol/L). Cyclin D and E protein levels were not affected by salicylate (Figure 6B). Cyclin A was undetectable in quiescent cells and was induced by PDGF stimulation beginning at 18 hours. This induction was completely suppressed by salicylate at all experimental time points. As with cyclins D and E, salicylate did not reduce the expression of Cdk-2, Cdk-4, or Cdk-6 (Figure 6B).

Effect of Salicylate on the Expression of Cdk Inhibitors
Compared with PDGF stimulation, cotreatment with salicylate did not significantly affect p16^Ink4 protein levels over 36 hours of treatment (Figure 6C). In contrast, levels of p27^Kip1 were high in quiescent cells and decreased progressively after PDGF stimulation. Cotreatment with salicylate (5 mmol/L) prevented this PDGF-induced decrease, with an effect predominating between 6 and 18 hours after stimulation. Levels of p21^Waf1 were low in quiescent SMCs. PDGF stimulation led to a transient increase in p21^Waf1 expression at 6 and 12 hours, with a return to baseline levels thereafter. Cotreatment with salicylate (5 mmol/L) increased p21^Waf1 expression over PDGF alone at 6 hours and prevented its decrease at subsequent time points. The expression of p21^Waf1 in salicylate-treated samples was 2.5- to 3.8-fold higher than the corresponding PDGF-treated controls between 24 and 36 hours of stimulation. Because the expression of p21^Waf1 is regulated, in part, by the tumor suppressor protein p53,²¹ we assessed the effect of salicylate on p53 protein expression. Salicylate (5 mmol/L) markedly upregulated p53 protein levels beginning at 6 hours and prevented the PDGF-induced decline in p53 expression at all subsequent time points (Figure 7).

View larger version (81K): [in this window] [in a new window]   Figure 7. Effect of salicylate on Cdk inhibitors and p53 protein levels. Immunoblots showing time-dependent effect of PDGF (4 ng/mL), salicylate (Sal, 5 mmol/L), or both on p16Ink4, p21Waf1, p27Kip1, and p53 levels. Three separate experiments yielded similar results.

Effect of Salicylate on NF-B Activation
SMCs possess minimal basal NF-B activation under tissue culture conditions (Figure 8A). Stimulation with PDGF increased NF-B activation, which was inhibited by cotreatment with salicylate (5 mmol/L) but not indomethacin (250 µmol/L). These results are in agreement with previous studies showing basal NF-B activation in SMCs^{17 22} and inhibition of NF-B by salicylates.²³ The inability of indomethacin to inhibit NF-B suggests that the mechanism is not mediated by inhibition of cyclooxygenase. Indeed, we found that salicylate, but not indomethacin, inhibited PDGF-induced IKK activity in SMCs (Figure 8B). Because the activation of NF-B is required for SMC proliferation,²⁴ our results suggest that inhibition of NF-B may be a partial mechanism by which high doses of salicylate inhibit SMC proliferation.

View larger version (33K): [in this window] [in a new window]   Figure 8. Effect of salicylate and indomethacin on NF-B activation and IKK activity. A, Electrophoretic mobility shift assay showing effect of salicylate (Sal, 5 mmol/L) and indomethacin (Indo, 250 µmol/L) on PDGF (4 ng/mL)–induced NF-B activation in SMCs. As controls, excess unlabeled (cold) or mutant B oligonucleotide (20 ng of each) was added to nuclear extracts. B, Kinase assay using GST–IB- fusion protein as substrate showing effect of salicylate (Sal, 5 mmol/L) and indomethacin (Indo, 250 µmol/L) on PDGF (4 ng/mL)–induced IKK-/ß activity at 2 hours. As controls for nonspecific phosphorylation, immunoprecipitation (IP) was performed with a nonspecific antibody to endothelial nitric oxide synthase (eNOS), and IB- mutant (32,36: ST) was used as substrate. Densitometric analyses of NF-B and phosphorylated GST–IB- bands for each condition from 3 separate experiments are shown below each figure. *P<0.05 vs PDGF alone.

	Discussion

Top Abstract Introduction Methods Results Discussion References

 
We have shown that high concentrations of salicylate inhibit SMC proliferation. We find that salicylate inhibited predominantly Cdk-2 activity, whereas it had a lesser effect on Cdk-6 and no effect on Cdk-4 activity. Although a number of Cdks are known to phosphorylate Rb, the suppression of Cdk-2 activity alone may be sufficient to prevent Rb hyperphosphorylation. For example, Cdk-2 can phosphorylate Rb in vitro, and microinjection of Cdk-2–cyclin E complexes induce DNA synthesis when injected into serum-starved human fibroblasts.^{25 26} Furthermore, several reports suggest that inhibition of Cdk-4 and Cdk-6 may not be necessary to arrest cell cycle progression and that inhibition of Cdk-2 alone may be sufficient to achieve cell cycle arrest.^{27 28 29}

The Cdk inhibitors p16^Ink4, p21^Waf1, and p27^Kip1 are important regulators of cyclin-Cdk complexes.⁸ Consistent with the role of p16^Ink4 as a selective inhibitor of Cdk-4 and Cdk-6 activity,^{9 12} p16^Ink4 levels and Cdk-4/-6 activities were relatively unaffected by salicylate. In contrast, salicylate prevented the downregulation of p27^Kip1 after PDGF stimulation and induced p21^Waf1. Although p21^Waf1 and p27^Kip1 have broad inhibitory activity on various cyclin-Cdk complexes, they have greater inhibitory effects on Cdk-2 activity. For example, p27^Kip1 overexpression completely inhibits Cdk-2 activity and cell growth without significant effect on Cdk-4 or Cdk-6 activity.^{30 31} Similarly, recombinant p21^Waf1 inhibits Cdk-2 but not Cdk-4 activity,³² and p21^Waf1-deficient mouse embryo fibroblasts show increased Cdk-2 but not Cdk-4 activity compared with wild-type cells.³³ Thus, our finding that salicylate selectively upregulates p21^Waf1 and p27^Kip1 expression is consistent with its greater inhibitory effect on Cdk-2 compared with that on Cdk-4/-6. Taken together, our data suggest that salicylate reduces SMC proliferation by blocking cell cycle progression from G₁ to S phase.

Salicylate has been shown to inhibit the proinflammatory transcription factor NF-B²³ in part by inhibiting IKK-ß, one of the kinases responsible for IB degradation.³⁴ NF-B is a member of the Rel family of transcription factors and plays an important role in the regulation of genes involved in inflammation, cell differentiation, and cell growth.³⁵ NF-B activity is essential for SMC proliferation,²⁴ and increased NF-B activity has been demonstrated in human atherosclerotic lesions³⁶ and in the rat carotid artery after balloon denudation.³⁷ Therefore, inhibition of NF-B may mediate some of the antiproliferative effects of salicylate on SMCs. Indeed, treatment of rats with high doses of aspirin (100 mg/kg) prevents NF-B activation and inhibits neointimal thickening after balloon injury.³⁸ However, the inhibition of NF-B by salicylate in the present study was relatively modest when compared with the compound’s effect on SMC proliferation. This suggests that additional pathways may be involved in the growth-inhibitory effect of salicylate.

	Acknowledgments

 
This work was supported by National Institutes of Health grants HL-52233 and HL-48743. Dr Liao is an Established Investigator of the American Heart Association. We thank Drs Peter Libby and Marysia Muszynski for providing human SMCs.

Received April 13, 2000; revision received May 30, 2000; accepted May 31, 2000.

	References

Top Abstract Introduction Methods Results Discussion References

 

1. Braun-Dullaeus RC, Mann MJ, Dzau VJ. Cell cycle progression: new therapeutic target for vascular proliferative disease. Circulation. 1998;98:82–89.[Abstract/Free Full Text]
   
2. Sherr CJ. Cancer cell cycles. Science. 1996;274:1672–1677.[Abstract/Free Full Text]
   
3. Zetterberg A, Larsson O. Cell cycle progression and cell growth in mammalian cells. In: Hutchinson C, Glover DM, eds. Frontiers in Molecular Biology: Cell Cycle Control. Oxford, UK: Oxford University Press; 1995.
   
4. Pines J. Protein kinases and cell cycle control. Semin Cell Biol. 1994;5:399–408.[Medline] [Order article via Infotrieve]
   
5. Weinberg RA. The retinoblastoma protein and cell cycle control. Cell. 1995;81:323–330.[Medline] [Order article via Infotrieve]
   
6. La Thangue NB. E2F and the molecular mechanisms of early cell-cycle control. Biochem Soc Trans. 1996;24:54–59.[Medline] [Order article via Infotrieve]
   
7. Nevins JR. E2F: a link between the Rb tumor suppressor protein and viral oncoproteins. Science. 1992;258:424–429.[Abstract/Free Full Text]
   
8. Elledge SJ, Harper JW. Cdk inhibitors: on the threshold of checkpoints and development. Curr Opin Cell Biol. 1994;6:847–852.[Medline] [Order article via Infotrieve]
   
9. Hannon GJ, Beach D. p15INK4B is a potential effector of TGF-beta-induced cell cycle arrest. Nature. 1994;371:257–261.[Medline] [Order article via Infotrieve]
   
10. Guan KL, Jenkins CW, Li Y, et al. Growth suppression by p18, a p16INK4/MTS1- and p14INK4B/MTS2-related CDK6 inhibitor, correlates with wild-type pRb function. Genes Dev. 1994;8:2939–2952.[Abstract/Free Full Text]
    
11. Chan FK, Zhang J, Cheng L, et al. Identification of human and mouse p19, a novel CDK4 and CDK6 inhibitor with homology to p16ink4. Mol Cell Biol. 1995;15:2682–2688.[Abstract]
    
12. Serrano M, Hannon GJ, Beach D. A new regulatory motif in cell-cycle control causing specific inhibition of cyclin D/CDK4. Nature. 1993;366:704–707.[Medline] [Order article via Infotrieve]
    
13. Xiong Y, Hannon GJ, Zhang H, et al. p21 is a universal inhibitor of cyclin kinases. Nature. 1993;366:701–704.[Medline] [Order article via Infotrieve]
    
14. Ricchi P, Pignata S, Di Popolo A, et al. Effect of aspirin on cell proliferation and differentiation of colon adenocarcinoma Caco-2 cells. Int J Cancer. 1997;73:880–884.[Medline] [Order article via Infotrieve]
    
15. Aas AT, Tonnessen TI, Brun A, et al. Growth inhibition of rat glioma cells in vitro and in vivo by aspirin. J Neurooncol. 1995;24:171–180.[Medline] [Order article via Infotrieve]
    
16. Bernhardt J, Rogalla K, Luscher TF, et al. Acetylsalicylic acid, at high concentrations, inhibits vascular smooth muscle cell proliferation. J Cardiovasc Pharmacol. 1993;21:973–976.[Medline] [Order article via Infotrieve]
    
17. Shin WS, Hong YH, Peng HB, et al. Nitric oxide attenuates vascular smooth muscle cell activation by interferon-gamma: the role of constitutive NF-kappa B activity. J Biol Chem. 1996;271:11317–11324.[Abstract/Free Full Text]
    
18. Spiecker M, Darius H, Kaboth K, et al. Differential regulation of endothelial cell adhesion molecule expression by nitric oxide donors and antioxidants. J Leukoc Biol. 1998;63:732–739.[Abstract]
    
19. Guijarro C, Blanco-Colio LM, Ortego M, et al. 3-Hydroxy-3-methylglutaryl coenzyme a reductase and isoprenylation inhibitors induce apoptosis of vascular smooth muscle cells in culture. Circ Res. 1998;83:490–500.[Abstract/Free Full Text]
    
20. Wyllie AH, Morris RG, Smith AL, et al. Chromatin cleavage in apoptosis: association with condensed chromatin morphology and dependence on macromolecular synthesis. J Pathol. 1984;142:67–77.[Medline] [Order article via Infotrieve]
    
21. Levine AJ. p53, the cellular gatekeeper for growth and division. Cell. 1997;88:323–331.[Medline] [Order article via Infotrieve]
    
22. Lawrence R, Chang LJ, Siebenlist U, et al. Vascular smooth muscle cells express a constitutive NF-kappa B-like activity. J Biol Chem. 1994;269:28913–28918.[Abstract/Free Full Text]
    
23. Kopp E, Ghosh S. Inhibition of NF-kappa B by sodium salicylate and aspirin. Science. 1994;265:956–959.[Abstract/Free Full Text]
    
24. Bellas RE, Lee JS, Sonenshein GE. Expression of a constitutive NF-kappa B-like activity is essential for proliferation of cultured bovine vascular smooth muscle cells. J Clin Invest. 1995;96:2521–2527.
    
25. Akiyama T, Ohuchi T, Sumida S, et al. Phosphorylation of the retinoblastoma protein by cdk2. Proc Natl Acad Sci U S A. 1992;89:7900–7904.[Abstract/Free Full Text]
    
26. Connell-Crowley L, Elledge SJ, Harper JW. G1 cyclin-dependent kinases are sufficient to initiate DNA synthesis in quiescent human fibroblasts. Curr Biol. 1998;8:65–68.[Medline] [Order article via Infotrieve]
    
27. Brooks EE, Gray NS, Joly A, et al. CVT-313, a specific and potent inhibitor of CDK2 that prevents neointimal proliferation. J Biol Chem. 1997;272:29207–29211.[Abstract/Free Full Text]
    
28. Ishida A, Sasaguri T, Kosaka C, et al. Induction of the cyclin-dependent kinase inhibitor p21(Sdi1/Cip1/Waf1) by nitric oxide-generating vasodilator in vascular smooth muscle cells. J Biol Chem. 1997;272:10050–10057.[Abstract/Free Full Text]
    
29. Sasaguri T, Ishida A, Kosaka C, et al. Phorbol ester inhibits the phosphorylation of the retinoblastoma protein without suppressing cyclin D-associated kinase in vascular smooth muscle cells. J Biol Chem. 1996;271:8345–8351.[Abstract/Free Full Text]
    
30. Polyak K, Lee MH, Erdjument-Bromage H, et al. Cloning of p27Kip1, a cyclin-dependent kinase inhibitor and a potential mediator of extracellular antimitogenic signals. Cell. 1994;78:59–66.[Medline] [Order article via Infotrieve]
    
31. Toyoshima H, Hunter T. p27, a novel inhibitor of G1 cyclin-Cdk protein kinase activity, is related to p21. Cell. 1994;78:67–74.[Medline] [Order article via Infotrieve]
    
32. Poon RYC, Jiang W, Toyoshima H, et al. Cyclin-dependent kinases are inactivated by a combination of p21 and Thr-14/Tyr-15 phosphorylation after UV-induced DNA damage. J Biol Chem. 1996;271:13283–13291.[Abstract/Free Full Text]
    
33. Brugarolas J, Bronson RT, Jacks T. p21 is a critical CDK2 regulator essential for proliferation control in Rb-deficient cells. J Cell Biol. 1998;141:503–514.[Abstract/Free Full Text]
    
34. Yin MJ, Yamamoto Y, Gaynor RB. The anti-inflammatory agents aspirin and salicylate inhibit the activity of I(kappa)B kinase-beta. Nature. 1998;396:77–80.[Medline] [Order article via Infotrieve]
    
35. Siebenlist U, Franzoso G, Brown K. Structure, regulation and function of NF-kappa B. Annu Rev Cell Biol. 1994;10:405–455.
    
36. Brand K, Page S, Rogler G, et al. Activated transcription factor nuclear factor-kappa B is present in the atherosclerotic lesion. J Clin Invest. 1996;97:1715–1722.[Medline] [Order article via Infotrieve]
    
37. Landry DB, Couper LL, Bryant SR, et al. Activation of the NF-kappa B and I kappa B system in smooth muscle cells after rat arterial injury: induction of vascular cell adhesion molecule-1 and monocyte chemoattractant protein-1. Am J Pathol. 1997;151:1085–1095.[Abstract]
    
38. Cercek B, Yamashita M, Dimayuga P, et al. Nuclear factor-kappaB activity and arterial response to balloon injury. Atherosclerosis. 1997;131:59–66.[Medline] [Order article via Infotrieve]
    

This article has been cited by other articles:

				B. M. Proctor, X. Jin, T. S. Lupu, L. J. Muglia, C. F. Semenkovich, and A. J. Muslin Requirement for p38 Mitogen-Activated Protein Kinase Activity in Neointima Formation After Vascular Injury Circulation, August 5, 2008; 118(6): 658 - 666. [Abstract] [Full Text] [PDF]

				A. P. C. Davel, L. E. Fukuda, L. L. De Sa, C. D. Munhoz, C. Scavone, D. Sanz-Rosa, V. Cachofeiro, V. Lahera, and L. V. Rossoni Effects of isoproterenol treatment for 7 days on inflammatory mediators in the rat aorta Am J Physiol Heart Circ Physiol, July 1, 2008; 295(1): H211 - H219. [Abstract] [Full Text] [PDF]

				K. Takeshita, M. Satoh, M. Ii, M. Silver, F. P. Limbourg, Y. Mukai, Y. Rikitake, F. Radtke, T. Gridley, D. W. Losordo, et al. Critical Role of Endothelial Notch1 Signaling in Postnatal Angiogenesis Circ. Res., January 5, 2007; 100(1): 70 - 78. [Abstract] [Full Text] [PDF]

				P. Dikshit, M. Chatterjee, A. Goswami, A. Mishra, and N. R. Jana Aspirin Induces Apoptosis through the Inhibition of Proteasome Function J. Biol. Chem., September 29, 2006; 281(39): 29228 - 29235. [Abstract] [Full Text] [PDF]

				D. M. Fries, R. Lightfoot, M. Koval, and H. Ischiropoulos Autologous Apoptotic Cell Engulfment Stimulates Chemokine Secretion by Vascular Smooth Muscle Cells Am. J. Pathol., August 1, 2005; 167(2): 345 - 353. [Abstract] [Full Text] [PDF]

				K. Sakakibara, K. Kubota, B. Worku, E. J. Ryer, J. P. Miller, A. Koff, K. C. Kent, and B. Liu PDGF-BB Regulates p27 Expression through ERK-dependent RNA Turn-over in Vascular Smooth Muscle Cells J. Biol. Chem., July 8, 2005; 280(27): 25470 - 25477. [Abstract] [Full Text] [PDF]

				S. Fasciano, R. C. Patel, I. Handy, and C. V. Patel Regulation of Vascular Smooth Muscle Proliferation by Heparin: INHIBITION OF CYCLIN-DEPENDENT KINASE 2 ACTIVITY BY p27kip1 J. Biol. Chem., April 22, 2005; 280(16): 15682 - 15689. [Abstract] [Full Text] [PDF]

				T. Kanda, K. Hayashi, S. Wakino, K. Homma, K. Yoshioka, K. Hasegawa, N. Sugano, S. Tatematsu, I. Takamatsu, T. Mitsuhashi, et al. Role of Rho-Kinase and p27 in Angiotensin II-Induced Vascular Injury Hypertension, April 1, 2005; 45(4): 724 - 729. [Abstract] [Full Text] [PDF]

				J.L. Mehta, J. Chen, F. Yu, and D.Y. Li Aspirin inhibits ox-LDL-mediated LOX-1 expression and metalloproteinase-1 in human coronary endothelial cells Cardiovasc Res, November 1, 2004; 64(2): 243 - 249. [Abstract] [Full Text] [PDF]

				T. Miyahara, H. Koyama, T. Miyata, H. Shigematsu, J.-I. Inoue, T. Takato, and H. Nagawa Inflammatory signaling pathway containing TRAF6 contributes to neointimal formation via diverse mechanisms Cardiovasc Res, October 1, 2004; 64(1): 154 - 164. [Abstract] [Full Text] [PDF]

				V. Andres Control of vascular cell proliferation and migration by cyclin-dependent kinase signalling: new perspectives and therapeutic potential Cardiovasc Res, July 1, 2004; 63(1): 11 - 21. [Abstract] [Full Text] [PDF]

				E. Torsney, U. Mayr, Y. Zou, W. D. Thompson, Y. Hu, and Q. Xu Thrombosis and Neointima Formation in Vein Grafts Are Inhibited by Locally Applied Aspirin Through Endothelial Protection Circ. Res., June 11, 2004; 94(11): 1466 - 1473. [Abstract] [Full Text] [PDF]

				Y. Gui and X.-L. Zheng Epidermal Growth Factor Induction of Phenotype-dependent Cell Cycle Arrest in Vascular Smooth Muscle Cells Is through the Mitogen-activated Protein Kinase Pathway J. Biol. Chem., December 26, 2003; 278(52): 53017 - 53025. [Abstract] [Full Text] [PDF]

				P. Ricchi, A. D. Palma, T. D. Matola, A. Apicella, R. Fortunato, R. Zarrilli, and A. M. Acquaviva Aspirin Protects Caco-2 Cells from Apoptosis after Serum Deprivation through the Activation of a Phosphatidylinositol 3-Kinase/AKT/p21Cip/WAF1Pathway Mol. Pharmacol., August 1, 2003; 64(2): 407 - 414. [Abstract] [Full Text] [PDF]

				G. A. Wong, V. Tang, F. El-Sabeawy, and R. H. Weiss BMP-2 inhibits proliferation of human aortic smooth muscle cells via p21Cip1/Waf1 Am J Physiol Endocrinol Metab, May 1, 2003; 284(5): E972 - E979. [Abstract] [Full Text] [PDF]

				Y.-C. Huang, L.-Y. Chuang, and W.-C. Hung Mechanisms Underlying Nonsteroidal Anti-Inflammatory Drug-Induced p27Kip1 Expression Mol. Pharmacol., December 1, 2002; 62(6): 1515 - 1521. [Abstract] [Full Text] [PDF]

				I. TEGEDER, J. PFEILSCHIFTER, and G. GEISSLINGER Cyclooxygenase-independent actions of cyclooxygenase inhibitors FASEB J, October 1, 2001; 15(12): 2057 - 2072. [Abstract] [Full Text] [PDF]

				G. CONDORELLI, J. K. AYCOCK, G. FRATI, and C. NAPOLI Mutated p21/WAF/CIP transgene overexpression reduces smooth muscle cell proliferation, macrophage deposition, oxidation-sensitive mechanisms, and restenosis in hypercholesterolemic apolipoprotein E knockout mice FASEB J, October 1, 2001; 15(12): 2162 - 2170. [Abstract] [Full Text] [PDF]

				K. Detmer, Z. Wang, D. Warejcka, S. K. Leeper-Woodford, and W. H. Newman Endotoxin stimulated cytokine production in rat vascular smooth muscle cells Am J Physiol Heart Circ Physiol, August 1, 2001; 281(2): H661 - H668. [Abstract] [Full Text] [PDF]