Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation
Search: search_blue_button Advanced Search
Circulation. 2000;102:1744-1747

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Guzik, T. J.
Right arrow Articles by Channon, K. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Guzik, T. J.
Right arrow Articles by Channon, K. M.
Related Collections
Right arrow Pathophysiology
Right arrow Genetics of cardiovascular disease
Right arrow Endothelium/vascular type/nitric oxide

(Circulation. 2000;102:1744.)
© 2000 American Heart Association, Inc.


Brief Rapid Communication

Functional Effect of the C242T Polymorphism in the NAD(P)H Oxidase p22phox Gene on Vascular Superoxide Production in Atherosclerosis

Tomasz J. Guzik, MD; Nick E. J. West, MRCP; Edward Black, FRCS; Denise McDonald, PhD; Chandi Ratnatunga, FRCS; Ravi Pillai, FRCS; Keith M. Channon, MD, MRCP

From the Departments of Cardiovascular Medicine (T.J.G., N.E.J.W., D.M., K.M.C.) and Cardiothoracic Surgery (E.B., C.R., R.P.), University of Oxford, John Radcliffe Hospital, Oxford, UK.

Correspondence to Keith M. Channon, MD, MRCP, Department of Cardiovascular Medicine, University of Oxford, John Radcliffe Hospital, Oxford OX3 9DU, UK. E-mail keith.channon{at}cardiov.ox.ac.uk


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Background—Increased superoxide anion production increases oxidative stress and reduces nitric oxide bioactivity in vascular disease states. NAD(P)H oxidase is an important source of superoxide in human blood vessels, and some studies suggest a possible association between polymorphisms in the NAD(P)H oxidase CYBA gene and atherosclerosis; however, no functional data address this hypothesis. We examined the relationships between the CYBA C242T polymorphism and direct measurements of superoxide production in human blood vessels.

Methods and Results—Vascular NAD(P)H oxidase activity was determined in human saphenous veins obtained from 110 patients with coronary artery disease and identified risk factors. Immunoblotting, reverse-transcription polymerase chain reaction, and DNA sequencing showed that p22phox protein, mRNA, and 242C/T allelic variants are expressed in human blood vessels. Vascular superoxide production, both basal and NADH-stimulated, was highly variable between patients, but the presence of the CYBA 242T allele was associated with significantly reduced vascular NAD(P)H oxidase activity, independent of other clinical risk factors for atherosclerosis.

Conclusions—Association of the CYBA 242T allele with reduced NAD(P)H oxidase activity in human blood vessels suggests that genetic variation in NAD(P)H oxidase components may play a significant role in modulating superoxide production in human atherosclerosis.


Key Words: atherosclerosis • endothelium • superoxide • genetics


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Oxidative stress plays critical roles in cardiovascular physiology and in the pathogenesis of vascular disease.1 Superoxide anion and its derivatives activate redox-sensitive signaling pathways, stimulate vascular smooth muscle cell mitogenesis, and regulate the signaling of hypoxia and apoptosis. In addition, nitric oxide scavenging by superoxide reduces the bioactivity of nitric oxide and produces peroxynitrite, a strong oxidant that nitrosylates cellular proteins and lipids. Increased superoxide production is a feature of vascular disease states, including atherosclerosis, hypertension and diabetes.2

NAD(P)H oxidase is present in vascular smooth muscle cells and endothelial cells, and it seems to be a major source of superoxide production in animal models of vascular disease2 and in human atherosclerosis.3 4 NAD(P)H oxidase is a multisubunit enzyme complex comprising p47phox, p67phox, gp91phox, p22phox, and Rac-2 proteins. The p22phox subunit is required for oxidase activity in smooth muscle cells, and it is expressed in human coronary arteries.5

Recent interest has focused on the possible association of polymorphisms in the CYBA gene, which encodes p22phox, with atherosclerosis.6 7 The CYBA C242T polymorphism results in a substitution of Tyr for His at residue 72 of p22phox, leading to speculation that this polymorphism may modulate enzyme activity by affecting heme binding.6 Recent data suggest that the CYBA 242T allele is associated with the increased progression of coronary disease.7 However, the relationship between the CYBA C242T polymorphism and vascular NAD(P)H oxidase activity in human blood vessels remains unknown.

Accordingly, we sought to investigate the functional effect of the CYBA C242T polymorphism on vascular superoxide production in human blood vessels. We found that the CYBA 242C/T alleles are expressed in p22phox mRNA in blood vessels and that the 242T allele is associated with significantly reduced vascular NAD(P)H oxidase activity, independent of other clinical risk factors for atherosclerosis.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Patients
Segments of human saphenous veins and mammary arteries were obtained from patients undergoing routine coronary artery bypass surgery at the John Radcliffe Hospital, Oxford, UK. Collection of tissue specimens was approved by the local Research Ethics Committee, and informed consent was obtained. Clinical risk factors (hypercholesterolemia, smoking, diabetes, and hypertension) were categorized as described previously.3

Genotyping and p22phox Expression
The C to T substitution at position 242 in the CYBA coding sequence was typed by RsaI digestion of specific polymerase chain reaction (PCR) products amplified from genomic DNA, as described previously.6 Reverse transcription (RT)-PCR of cDNA synthesized from mRNA extracted from vessel segments was performed using specific intron-spanning primers (forward: 5'CGCTGGCGTCCGGCCTGATCCTCA3'; reverse: 5'ACGCACAGCCGCCAGTAGGTAGAT3'). RT-PCR products (341 bp) were digested with RsaI or were sequenced using automated dye sequencing in both directions. Western immunoblotting of vessel homogenates for p22phox protein was performed using polyclonal antibodies provided by Dr Imajoh-Ohmi (Tokyo, Japan).5

Superoxide Determination
Basal and NADH-stimulated superoxide production were measured from vascular segments using lucigenin-enhanced chemiluminescence (5 µmol/L lucigenin), as previously described.3

Statistical Analysis
Data are expressed as mean±SEM. Statistical significance of differences between superoxide production was assessed by Student’s t tests. Relationships between superoxide production and risk factors or CYBA genotype were analyzed using ANOVA (type III sums of squares). P<0.05 was considered statistically significant.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Patient Characteristics
Saphenous veins were obtained from 110 patients (89 men and 21 women) undergoing coronary artery bypass grafting. Demographic and clinical characteristics are shown in Table 1Down.


View this table:
[in this window]
[in a new window]
 
Table 1. Clinical and Demographic Characteristics of Patients

Frequencies of p22phox C242T Genotypes
The frequency of the C allele at CYBA position 242 was 67% and that of the T allele was 33%. Genotype frequencies were as follows: CC, 45.4%; CT, 43.6%; and TT, 10.9%. These frequencies were in accordance with the Hardy-Weinberg distribution ({chi}2=0.02, P=0.99).

Relationship Between Vascular Superoxide Generation and CYBA Genotype
To investigate the relationship between vascular NAD(P)H oxidase activity and CYBA genotype, we compared both basal and NADH-stimulated superoxide production in vessel segments from patients with or without the CYBA 242 T allele (Figure 1Down). The addition of NADH stimulated superoxide release >10-fold (19.9±2 at baseline versus 285±13 after NADH; P<0.001). Both basal and maximal NAD(P)H oxidase activity were significantly lower, by {approx}30%, in vessels from patients with the T allele (CT/TT genotypes) compared with those from patients without the T allele (CC genotype). No differences in superoxide production existed between the CT and TT genotypes (CT: n=48, 251±16; TT: n=12, 247±24; P=NS).



View larger version (31K):
[in this window]
[in a new window]
 
Figure 1. Superoxide production was determined from 110 saphenous veins using lucigenin-enhanced chemiluminescence under basal conditions and then after stimulation with NADH (100 µmol/L). Bars show mean±SEM according to p22phox genotype. *P<0.01.

An analysis of major clinical risk factors for atherosclerosis that could affect vascular superoxide production revealed that diabetes and hypercholesterolemia were strongly associated with increased NAD(P)H oxidase activity (Table 2Down), but the presence of the CYBA 242T allele remained independently associated with reduced vascular NAD(P)H oxidase activity (P<0.001). In particular, the CC and CT/TT groups were well-matched for the proportion of diabetics (CC, 11 of 50; CC/TT, 15 of 60; P=0.2) and for drug therapies, including hydroxymethylglutaryl–coenzyme A reductase inhibitors and angiotensin-converting enzyme inhibitors.


View this table:
[in this window]
[in a new window]
 
Table 2. Risk Factors Associated With Vascular NADH-Dependent Superoxide Release

We also measured NADH-dependent superoxide production from paired internal mammary artery segments from 30 patients and found a close correlation with saphenous vein superoxide production in individual patients (r=0.6, P<0.01). In accordance with our findings in saphenous veins, NADH-dependent superoxide production in mammary arteries was significantly lower in those with the CT/TT genotype (n=17) than in those with the CC genotype (n=13; 150±17 versus 210±21; P=0.04).

Expression and Molecular Identification of p22phox in Human Blood Vessels
We evaluated p22phox expression in saphenous veins using Western immunoblotting of vascular homogenates and RT-PCR of saphenous vein mRNA with restriction analysis and DNA sequencing. Immunoblotting revealed p22phox protein in saphenous vein homogenates from patients with different CYBA genotypes (Figure 2Down). Similarly, RT-PCR of saphenous vein mRNA generated a specific product in all genotypes; DNA sequencing showed an identity with neutrophil p22phox. Furthermore, restriction analysis and sequencing of RT-PCR products from patients with CC, CT, or TT genotypes confirmed the expression of the alleles in each case, in accordance with the genotype determined directly from genomic DNA. We also found p22phox protein, mRNA, and C/T allelic variants in samples from the internal mammary artery.



View larger version (81K):
[in this window]
[in a new window]
 
Figure 2. Expression and molecular identification of p22phox in human blood vessels. Protein and mRNA were extracted from human saphenous veins (HSV; n=6) and from internal mammary arteries (IMA; n=3) obtained from patients with CC, CT, or TT genotypes. Upper panels show genotype determined by RsaI digestion of PCR products from genomic DNA (Genomic RFLP), p22phox immunoblotting (p22phox Protein), RT-PCR of saphenous vein using p22phox-specific primers (p22phox RT-PCR), and allele-specific RsaI digestion of RT-PCR products (RT-PCR RFLP). Arrows show size of DNA fragments in base pairs (bp) or protein bands (kDal). Lower panel shows portions of DNA sequence of p22phox RT-PCR products from saphenous veins or mammary arteries from patients with CC or TT genotypes, aligned with sequence of neutrophil p22phox (GenBank #M21186).

These data confirm that p22phox is expressed in saphenous veins (both mRNA and protein), that the molecular identity is the same as that expressed in neutrophils and mammary arteries, and that the expression of C and/or T alleles in blood vessels corresponds with genotype.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
We studied the relationship between vascular superoxide production and the CYBA C242T polymorphism in the gene encoding the NAD(P)H oxidase p22phox subunit. We found that the 242T allele is associated with significantly lower basal and NADH-stimulated vascular superoxide production in human blood vessels from patients with atherosclerosis. We also confirmed the molecular identity and allele-specific expression of p22phox in human vessels. These findings provide direct functional data relating vascular superoxide production in human atherosclerosis to genetic polymorphisms in the CYBA gene. Previous studies have examined the incidence of CYBA polymorphisms in association with coronary artery disease. Inoue et al6 found that the 242T allele was associated with a reduced risk of coronary artery disease, whereas other case-control studies had conflicting findings.8 9 However, the genotyping of patients in the prospective Lipoprotein and Coronary Artery Study (LCAS) suggested a significant association between the CYBA 242T allele and the progression of coronary atherosclerosis.7

By analyzing a quantitative trait, vascular NAD(P)H oxidase activity, we found a significant functional effect of this polymorphism, thus supporting a potential role for CYBA polymorphisms in vascular disease pathogenesis. Our functional data agree with the previous observation that the presence of the CYBA 242T allele seems to exert a dominant effect,7 because we found an equal reduction in vascular NAD(P)H oxidase activity in patients with CT or TT genotypes compared with the CC genotype.

Our findings suggest that the CYBA 242T allele is associated with reduced NAD(P)H oxidase activity under both basal and maximal (NADH-stimulated) conditions, although the mechanisms underlying these effects and their implications for the pathogenesis of atherosclerosis remain unclear. One plausible mechanism is the resulting His to Tyr substitution at position 72 of p22phox that could possibly disrupt heme binding at the active site.6 10 Because most studies suggest that vascular superoxide production by NAD(P)H oxidase is increased rather than decreased in atherosclerosis, the association of the T allele with reduced oxidase activity may seem counterintuitive.10 However, the balance between antioxidant stress and up-regulation of antioxidant defenses remains poorly defined; it is possible that increased superoxide production could augment protective mechanisms against disease progression. For example, nitric oxide–mediated vasorelaxations do not seem to be affected by the CYBA C242T polymorphism.11 Furthermore, NAD(P)H oxidase may play important roles in regulating other cellular processes, such as oxygen sensing, smooth muscle cell mitogenesis, redox-sensitive gene expression, and apoptosis, which could all provide targets for the differential effects of p22phox variants in atherosclerosis.4 10 Alternatively, the CYBA 242T allele may be an indirect marker for other genetic variants that influence the expression of CYBA or other gene(s), regulate p22phox protein activity, or affect atherosclerotic progression. Finally, our in vitro assays using saphenous veins may not reflect superoxide production in coronary arteries in vivo.

In conclusion, the CYBA C242T polymorphism significantly affects vascular superoxide production in patients with coronary artery disease. The presence of the 242T allele is independently associated with reduced basal and NADH-stimulated superoxide production, suggesting a potentially important role for genetic variation in NAD(P)H oxidase in human atherosclerosis.


*    Acknowledgments
 
This study was supported by the Garfield Weston Trust and the British Heart Foundation. Dr Guzik is a Crescendum Est Polonia Foundation Fellow.

Received July 28, 2000; revision received August 17, 2000; accepted August 21, 2000.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Kojda G, Harrison D. Interactions between NO and reactive oxygen species: pathophysiological importance in atherosclerosis, hypertension, diabetes and heart failure. Cardiovasc Res. 1999;43:562–571.[Medline] [Order article via Infotrieve]

2. Warnholtz A, Nickenig G, Schulz E, et al. Increased NADH-oxidase-mediated superoxide production in the early stages of atherosclerosis: evidence for involvement of the renin- angiotensin system. Circulation.. 1999;99:2027–2033.[Abstract/Free Full Text]

3. Guzik TJ, West NEJ, Black E, et al. Vascular superoxide production by NAD(P)H oxidase: association with endothelial dysfunction and clinical risk factors. Circ Res. 2000;86:e85–e90.

4. Griendling KK, Sorescu D, Ushio-Fukai M. NAD(P)H oxidase: role in cardiovascular biology and disease. Circ Res. 2000;86:494–501.[Abstract/Free Full Text]

5. Azumi H, Inoue N, Takeshita S, et al. Expression of NADH/NADPH oxidase p22phox in human coronary arteries. Circulation. 1999;100:1494–1498.[Abstract/Free Full Text]

6. Inoue N, Kawashima S, Kanazawa K, et al. Polymorphism of the NADH/NADPH oxidase p22phox gene in patients with coronary artery disease. Circulation. 1998;97:135–137.[Abstract/Free Full Text]

7. Cahilly C, Ballantyne CM, Lim DS, et al. A variant of p22(phox), involved in generation of reactive oxygen species in the vessel wall, is associated with progression of coronary atherosclerosis. Circ Res. 2000;86:391–395.[Abstract/Free Full Text]

8. Ito D, Murata M, Watanabe K, et al. C242T polymorphism of NADPH oxidase p22phox gene and ischemic cerebrovascular disease in the Japanese population. Stroke. 2000;31:936–939.[Abstract/Free Full Text]

9. Gardemann A, Mages P, Katz N, et al. The p22 phox A640G gene polymorphism but not the C242T gene variation is associated with coronary heart disease in younger individuals. Atherosclerosis. 1999;145:315–323.[Medline] [Order article via Infotrieve]

10. Wolin MS. How could a genetic variant of the p22(phox) component of NAD(P)H oxidases contribute to the progression of coronary atherosclerosis? Circ Res. 2000;86:365–366.[Free Full Text]

11. Li A, Prasad A, Mincemoyer R, et al. Relationship of the C242T p22phox gene polymorphism to angiographic coronary artery disease and endothelial function. Am J Med Genet.. 1999;86:57–61.[Medline] [Order article via Infotrieve]




This article has been cited by other articles:


Home page
Diabetes CareHome page
N. Katakami, K. Sakamoto, H. Kaneto, M. Matsuhisa, K. Ohno, I. Shimizu, F. Ishibashi, T. Osonoi, A. Kashiwagi, R. Kawamori, et al.
Cumulative Effect of Oxidative Stress-Related Gene Polymorphisms on Myocardial Infarction in Type 2 Diabetes
Diabetes Care, May 1, 2009; 32(5): e55 - e55.
[Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
M. Arca, B. Conti, A. Montali, P. Pignatelli, F. Campagna, F. Barilla, G. Tanzilli, R. Verna, A. Vestri, C. Gaudio, et al.
C242T Polymorphism of NADPH Oxidase p22phox and Recurrence of Cardiovascular Events in Coronary Artery Disease
Arterioscler Thromb Vasc Biol, April 1, 2008; 28(4): 752 - 757.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
C. Shirodaria, C. Antoniades, J. Lee, C. E. Jackson, M. D. Robson, J. M. Francis, S. J. Moat, C. Ratnatunga, R. Pillai, H. Refsum, et al.
Global Improvement of Vascular Function and Redox State With Low-Dose Folic Acid: Implications for Folate Therapy in Patients With Coronary Artery Disease
Circulation, May 1, 2007; 115(17): 2262 - 2270.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
K. Doi, E. Noiri, A. Nakao, T. Fujita, S. Kobayashi, and K. Tokunaga
Functional Polymorphisms in the Vascular Endothelial Growth Factor Gene Are Associated with Development of End-Stage Renal Disease in Males
J. Am. Soc. Nephrol., March 1, 2006; 17(3): 823 - 830.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
L. Wojnowski, B. Kulle, M. Schirmer, G. Schluter, A. Schmidt, A. Rosenberger, S. Vonhof, H. Bickeboller, M. R. Toliat, E.-K. Suk, et al.
NAD(P)H Oxidase and Multidrug Resistance Protein Genetic Polymorphisms Are Associated With Doxorubicin-Induced Cardiotoxicity
Circulation, December 13, 2005; 112(24): 3754 - 3762.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
J.-Y. Park, R. E. Ferrell, J.-J. Park, J. M. Hagberg, D. A. Phares, J. M. Jones, and M. D. Brown
NADPH oxidase p22phox gene variants are associated with systemic oxidative stress biomarker responses to exercise training
J Appl Physiol, November 1, 2005; 99(5): 1905 - 1911.
[Abstract] [Full Text] [PDF]


Home page
HeartHome page
L C Jones and A D Hingorani
Genetic regulation of endothelial function
Heart, October 1, 2005; 91(10): 1275 - 1277.
[Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
J. A. Leopold and J. Loscalzo
Oxidative Enzymopathies and Vascular Disease
Arterioscler Thromb Vasc Biol, July 1, 2005; 25(7): 1332 - 1340.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
G. Zalba, O. Beloqui, G. S. Jose, M. U. Moreno, A. Fortuno, and J. Diez
NADPH Oxidase-Dependent Superoxide Production Is Associated With Carotid Intima-Media Thickness in Subjects Free of Clinical Atherosclerotic Disease
Arterioscler Thromb Vasc Biol, July 1, 2005; 25(7): 1452 - 1457.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
T. J. Guzik, J. Sadowski, B. Kapelak, A. Jopek, P. Rudzinski, R. Pillai, R. Korbut, and K. M. Channon
Systemic Regulation of Vascular NAD(P)H Oxidase Activity and Nox Isoform Expression in Human Arteries and Veins
Arterioscler Thromb Vasc Biol, September 1, 2004; 24(9): 1614 - 1620.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
G. S. Jose, M. U. Moreno, S. Olivan, O. Beloqui, A. Fortuno, J. Diez, and G. Zalba
Functional Effect of the p22phox -930A/G Polymorphism on p22phox Expression and NADPH Oxidase Activity in Hypertension
Hypertension, August 1, 2004; 44(2): 163 - 169.
[Abstract] [Full Text] [PDF]


Home page
Eur Heart JHome page
K. M Channon and H. Watkins
Coronary artery disease genetics: bigger is better
Eur. Heart J., June 1, 2004; 25(11): 900 - 901.
[Full Text] [PDF]


Home page
Eur Heart JHome page
Y. Murase, Y. Yamada, A. Hirashiki, S. Ichihara, H. Kanda, M. Watarai, F. Takatsu, T. Murohara, and M. Yokota
Genetic risk and gene-environment interaction in coronary artery spasm in Japanese men and women
Eur. Heart J., June 1, 2004; 25(11): 970 - 977.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
K. E. Wyche, S. S. Wang, K. K. Griendling, S. I. Dikalov, H. Austin, S. Rao, B. Fink, D. G. Harrison, and A. M. Zafari
C242T CYBA Polymorphism of the NADPH Oxidase Is Associated With Reduced Respiratory Burst in Human Neutrophils
Hypertension, June 1, 2004; 43(6): 1246 - 1251.
[Abstract] [Full Text] [PDF]


Home page
Diabetes CareHome page
S. Matsunaga-Irie, T. Maruyama, Y. Yamamoto, Y. Motohashi, H. Hirose, A. Shimada, M. Murata, and T. Saruta
Relation Between Development of Nephropathy and the p22phox C242T and Receptor for Advanced Glycation End Product G1704T Gene Polymorphisms in Type 2 Diabetic Patients
Diabetes Care, February 1, 2004; 27(2): 303 - 307.
[Abstract] [Full Text] [PDF]


Home page
StrokeHome page
T. M. Paravicini, S. Chrissobolis, G. R. Drummond, and C. G. Sobey
Increased NADPH-Oxidase Activity and Nox4 Expression During Chronic Hypertension Is Associated With Enhanced Cerebral Vasodilatation to NADPH In Vivo
Stroke, February 1, 2004; 35(2): 584 - 589.
[Abstract] [Full Text] [PDF]


Home page
Diabetes CareHome page
A. D. Hodgkinson, B. A. Millward, and A. G. Demaine
Association of the p22phox Component of NAD(P)H Oxidase With Susceptibility to Diabetic Nephropathy in Patients With Type 1 Diabetes
Diabetes Care, November 1, 2003; 26(11): 3111 - 3115.
[Abstract] [Full Text] [PDF]


Home page
Diabetes CareHome page
R. Hayaishi-Okano, Y. Yamasaki, Y. Kajimoto, K.'y. Sakamoto, K. Ohtoshi, N. Katakami, D. Kawamori, T. Miyatsuka, M. Hatazaki, Y. Hazama, et al.
Association of NAD(P)H Oxidase p22 phox Gene Variation With Advanced Carotid Atherosclerosis in Japanese Type 2 Diabetes
Diabetes Care, February 1, 2003; 26(2): 458 - 463.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
Y. Yamada, H. Izawa, S. Ichihara, F. Takatsu, H. Ishihara, H. Hirayama, T. Sone, M. Tanaka, and M. Yokota
Prediction of the Risk of Myocardial Infarction from Polymorphisms in Candidate Genes
N. Engl. J. Med., December 12, 2002; 347(24): 1916 - 1923.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
G. Wolf, U. Panzer, S. Harendza, U. Wenzel, and R. A. K. Stahl
No association between a genetic variant of the p22phox component of NAD(P)H oxidase and the incidence and progression of IgA nephropathy
Nephrol. Dial. Transplant., August 1, 2002; 17(8): 1509 - 1512.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
T. M. Paravicini, L. M. Gulluyan, G. J. Dusting, and G. R. Drummond
Increased NADPH Oxidase Activity, gp91phox Expression, and Endothelium-Dependent Vasorelaxation During Neointima Formation in Rabbits
Circ. Res., July 12, 2002; 91(1): 54 - 61.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
G. Zalba, G. S. Jose, M. U. Moreno, M. A. Fortuno, A. Fortuno, F. J. Beaumont, and J. Diez
Oxidative Stress in Arterial Hypertension: Role of NAD(P)H Oxidase
Hypertension, December 1, 2001; 38(6): 1395 - 1399.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
G. Zalba, G. S. Jose, F. J. Beaumont, M. A. Fortuno, A. Fortuno, and J. Diez
Polymorphisms and Promoter Overactivity of the p22phox Gene in Vascular Smooth Muscle Cells From Spontaneously Hypertensive Rats
Circ. Res., February 2, 2001; 88(2): 217 - 222.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
A. S. Whitehead and G. A. FitzGerald
Twenty-First Century Phox: Not Yet Ready for Widespread Screening
Circulation, January 2, 2001; 103(1): 7 - 9.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Guzik, T. J.
Right arrow Articles by Channon, K. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Guzik, T. J.
Right arrow Articles by Channon, K. M.
Related Collections
Right arrow Pathophysiology
Right arrow Genetics of cardiovascular disease
Right arrow Endothelium/vascular type/nitric oxide