(Circulation. 2000;102:1744.)
© 2000 American Heart Association, Inc.
Brief Rapid Communication |
From the Departments of Cardiovascular Medicine (T.J.G., N.E.J.W., D.M., K.M.C.) and Cardiothoracic Surgery (E.B., C.R., R.P.), University of Oxford, John Radcliffe Hospital, Oxford, UK.
Correspondence to Keith M. Channon, MD, MRCP, Department of Cardiovascular Medicine, University of Oxford, John Radcliffe Hospital, Oxford OX3 9DU, UK. E-mail keith.channon{at}cardiov.ox.ac.uk
| Abstract |
|---|
|
|
|---|
Methods and ResultsVascular NAD(P)H oxidase activity was determined in human saphenous veins obtained from 110 patients with coronary artery disease and identified risk factors. Immunoblotting, reverse-transcription polymerase chain reaction, and DNA sequencing showed that p22phox protein, mRNA, and 242C/T allelic variants are expressed in human blood vessels. Vascular superoxide production, both basal and NADH-stimulated, was highly variable between patients, but the presence of the CYBA 242T allele was associated with significantly reduced vascular NAD(P)H oxidase activity, independent of other clinical risk factors for atherosclerosis.
ConclusionsAssociation of the CYBA 242T allele with reduced NAD(P)H oxidase activity in human blood vessels suggests that genetic variation in NAD(P)H oxidase components may play a significant role in modulating superoxide production in human atherosclerosis.
Key Words: atherosclerosis endothelium superoxide genetics
| Introduction |
|---|
|
|
|---|
NAD(P)H oxidase is present in vascular smooth muscle cells and endothelial cells, and it seems to be a major source of superoxide production in animal models of vascular disease2 and in human atherosclerosis.3 4 NAD(P)H oxidase is a multisubunit enzyme complex comprising p47phox, p67phox, gp91phox, p22phox, and Rac-2 proteins. The p22phox subunit is required for oxidase activity in smooth muscle cells, and it is expressed in human coronary arteries.5
Recent interest has focused on the possible association of polymorphisms in the CYBA gene, which encodes p22phox, with atherosclerosis.6 7 The CYBA C242T polymorphism results in a substitution of Tyr for His at residue 72 of p22phox, leading to speculation that this polymorphism may modulate enzyme activity by affecting heme binding.6 Recent data suggest that the CYBA 242T allele is associated with the increased progression of coronary disease.7 However, the relationship between the CYBA C242T polymorphism and vascular NAD(P)H oxidase activity in human blood vessels remains unknown.
Accordingly, we sought to investigate the functional effect of the CYBA C242T polymorphism on vascular superoxide production in human blood vessels. We found that the CYBA 242C/T alleles are expressed in p22phox mRNA in blood vessels and that the 242T allele is associated with significantly reduced vascular NAD(P)H oxidase activity, independent of other clinical risk factors for atherosclerosis.
| Methods |
|---|
|
|
|---|
Genotyping and p22phox Expression
The C to T substitution at position 242 in the CYBA
coding sequence was typed by RsaI digestion of specific
polymerase chain reaction (PCR) products amplified from genomic
DNA, as described previously.6 Reverse transcription
(RT)-PCR of cDNA synthesized from mRNA extracted from vessel segments
was performed using specific intron-spanning primers (forward:
5'CGCTGGCGTCCGGCCTGATCCTCA3'; reverse: 5'ACGCACAGCCGCCAGTAGGTAGAT3').
RT-PCR products (341 bp) were digested with RsaI or were
sequenced using automated dye sequencing in both directions. Western
immunoblotting of vessel homogenates for
p22phox protein was performed using polyclonal antibodies provided by
Dr Imajoh-Ohmi (Tokyo, Japan).5
Superoxide Determination
Basal and NADH-stimulated superoxide production were
measured from vascular segments using lucigenin-enhanced
chemiluminescence (5 µmol/L lucigenin), as previously
described.3
Statistical Analysis
Data are expressed as mean±SEM. Statistical significance of
differences between superoxide production was assessed by
Students t tests. Relationships between superoxide
production and risk factors or CYBA genotype
were analyzed using ANOVA (type III sums of squares).
P<0.05 was considered statistically significant.
| Results |
|---|
|
|
|---|
|
Frequencies of p22phox C242T Genotypes
The frequency of the C allele at CYBA position 242
was 67% and that of the T allele was 33%. Genotype
frequencies were as follows: CC, 45.4%; CT, 43.6%; and TT, 10.9%.
These frequencies were in accordance with the Hardy-Weinberg
distribution (
2=0.02, P=0.99).
Relationship Between Vascular Superoxide Generation and
CYBA Genotype
To investigate the relationship between vascular NAD(P)H oxidase
activity and CYBA genotype, we compared both basal
and NADH-stimulated superoxide production in vessel segments
from patients with or without the CYBA 242 T allele
(Figure 1
). The addition of NADH
stimulated superoxide release >10-fold (19.9±2 at baseline versus
285±13 after NADH; P<0.001). Both basal and maximal
NAD(P)H oxidase activity were significantly lower, by
30%, in
vessels from patients with the T allele (CT/TT genotypes)
compared with those from patients without the T allele (CC
genotype). No differences in superoxide production
existed between the CT and TT genotypes (CT: n=48, 251±16; TT:
n=12, 247±24; P=NS).
|
An analysis of major clinical risk factors for
atherosclerosis that could affect vascular superoxide
production revealed that diabetes and
hypercholesterolemia were strongly associated
with increased NAD(P)H oxidase activity (Table 2
), but the presence of the
CYBA 242T allele remained independently associated with
reduced vascular NAD(P)H oxidase activity (P<0.001). In
particular, the CC and CT/TT groups were well-matched for the
proportion of diabetics (CC, 11 of 50; CC/TT, 15 of 60;
P=0.2) and for drug therapies, including
hydroxymethylglutarylcoenzyme A reductase
inhibitors and angiotensin-converting enzyme
inhibitors.
|
We also measured NADH-dependent superoxide production from paired internal mammary artery segments from 30 patients and found a close correlation with saphenous vein superoxide production in individual patients (r=0.6, P<0.01). In accordance with our findings in saphenous veins, NADH-dependent superoxide production in mammary arteries was significantly lower in those with the CT/TT genotype (n=17) than in those with the CC genotype (n=13; 150±17 versus 210±21; P=0.04).
Expression and Molecular Identification of p22phox in Human
Blood Vessels
We evaluated p22phox expression in saphenous veins using Western
immunoblotting of vascular homogenates and
RT-PCR of saphenous vein mRNA with restriction analysis and DNA
sequencing. Immunoblotting revealed p22phox protein in
saphenous vein homogenates from patients with different
CYBA genotypes (Figure 2
). Similarly, RT-PCR of saphenous vein
mRNA generated a specific product in all genotypes; DNA
sequencing showed an identity with neutrophil p22phox. Furthermore,
restriction analysis and sequencing of RT-PCR products from
patients with CC, CT, or TT genotypes confirmed the expression
of the alleles in each case, in accordance with the
genotype determined directly from genomic DNA. We also found
p22phox protein, mRNA, and C/T allelic variants in samples from the
internal mammary artery.
|
These data confirm that p22phox is expressed in saphenous veins (both mRNA and protein), that the molecular identity is the same as that expressed in neutrophils and mammary arteries, and that the expression of C and/or T alleles in blood vessels corresponds with genotype.
| Discussion |
|---|
|
|
|---|
By analyzing a quantitative trait, vascular NAD(P)H oxidase activity, we found a significant functional effect of this polymorphism, thus supporting a potential role for CYBA polymorphisms in vascular disease pathogenesis. Our functional data agree with the previous observation that the presence of the CYBA 242T allele seems to exert a dominant effect,7 because we found an equal reduction in vascular NAD(P)H oxidase activity in patients with CT or TT genotypes compared with the CC genotype.
Our findings suggest that the CYBA 242T allele is associated with reduced NAD(P)H oxidase activity under both basal and maximal (NADH-stimulated) conditions, although the mechanisms underlying these effects and their implications for the pathogenesis of atherosclerosis remain unclear. One plausible mechanism is the resulting His to Tyr substitution at position 72 of p22phox that could possibly disrupt heme binding at the active site.6 10 Because most studies suggest that vascular superoxide production by NAD(P)H oxidase is increased rather than decreased in atherosclerosis, the association of the T allele with reduced oxidase activity may seem counterintuitive.10 However, the balance between antioxidant stress and up-regulation of antioxidant defenses remains poorly defined; it is possible that increased superoxide production could augment protective mechanisms against disease progression. For example, nitric oxidemediated vasorelaxations do not seem to be affected by the CYBA C242T polymorphism.11 Furthermore, NAD(P)H oxidase may play important roles in regulating other cellular processes, such as oxygen sensing, smooth muscle cell mitogenesis, redox-sensitive gene expression, and apoptosis, which could all provide targets for the differential effects of p22phox variants in atherosclerosis.4 10 Alternatively, the CYBA 242T allele may be an indirect marker for other genetic variants that influence the expression of CYBA or other gene(s), regulate p22phox protein activity, or affect atherosclerotic progression. Finally, our in vitro assays using saphenous veins may not reflect superoxide production in coronary arteries in vivo.
In conclusion, the CYBA C242T polymorphism significantly affects vascular superoxide production in patients with coronary artery disease. The presence of the 242T allele is independently associated with reduced basal and NADH-stimulated superoxide production, suggesting a potentially important role for genetic variation in NAD(P)H oxidase in human atherosclerosis.
| Acknowledgments |
|---|
Received July 28, 2000; revision received August 17, 2000; accepted August 21, 2000.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
M. Arca, B. Conti, A. Montali, P. Pignatelli, F. Campagna, F. Barilla, G. Tanzilli, R. Verna, A. Vestri, C. Gaudio, et al. C242T Polymorphism of NADPH Oxidase p22phox and Recurrence of Cardiovascular Events in Coronary Artery Disease Arterioscler. Thromb. Vasc. Biol., April 1, 2008; 28(4): 752 - 757. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Shirodaria, C. Antoniades, J. Lee, C. E. Jackson, M. D. Robson, J. M. Francis, S. J. Moat, C. Ratnatunga, R. Pillai, H. Refsum, et al. Global Improvement of Vascular Function and Redox State With Low-Dose Folic Acid: Implications for Folate Therapy in Patients With Coronary Artery Disease Circulation, May 1, 2007; 115(17): 2262 - 2270. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Doi, E. Noiri, A. Nakao, T. Fujita, S. Kobayashi, and K. Tokunaga Functional Polymorphisms in the Vascular Endothelial Growth Factor Gene Are Associated with Development of End-Stage Renal Disease in Males J. Am. Soc. Nephrol., March 1, 2006; 17(3): 823 - 830. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Wojnowski, B. Kulle, M. Schirmer, G. Schluter, A. Schmidt, A. Rosenberger, S. Vonhof, H. Bickeboller, M. R. Toliat, E.-K. Suk, et al. NAD(P)H Oxidase and Multidrug Resistance Protein Genetic Polymorphisms Are Associated With Doxorubicin-Induced Cardiotoxicity Circulation, December 13, 2005; 112(24): 3754 - 3762. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-Y. Park, R. E. Ferrell, J.-J. Park, J. M. Hagberg, D. A. Phares, J. M. Jones, and M. D. Brown NADPH oxidase p22phox gene variants are associated with systemic oxidative stress biomarker responses to exercise training J Appl Physiol, November 1, 2005; 99(5): 1905 - 1911. [Abstract] [Full Text] [PDF] |
||||
![]() |
L C Jones and A D Hingorani Genetic regulation of endothelial function Heart, October 1, 2005; 91(10): 1275 - 1277. [Full Text] [PDF] |
||||
![]() |
J. A. Leopold and J. Loscalzo Oxidative Enzymopathies and Vascular Disease Arterioscler. Thromb. Vasc. Biol., July 1, 2005; 25(7): 1332 - 1340. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Zalba, O. Beloqui, G. S. Jose, M. U. Moreno, A. Fortuno, and J. Diez NADPH Oxidase-Dependent Superoxide Production Is Associated With Carotid Intima-Media Thickness in Subjects Free of Clinical Atherosclerotic Disease Arterioscler. Thromb. Vasc. Biol., July 1, 2005; 25(7): 1452 - 1457. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. J. Guzik, J. Sadowski, B. Kapelak, A. Jopek, P. Rudzinski, R. Pillai, R. Korbut, and K. M. Channon Systemic Regulation of Vascular NAD(P)H Oxidase Activity and Nox Isoform Expression in Human Arteries and Veins Arterioscler. Thromb. Vasc. Biol., September 1, 2004; 24(9): 1614 - 1620. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. S. Jose, M. U. Moreno, S. Olivan, O. Beloqui, A. Fortuno, J. Diez, and G. Zalba Functional Effect of the p22phox -930A/G Polymorphism on p22phox Expression and NADPH Oxidase Activity in Hypertension Hypertension, August 1, 2004; 44(2): 163 - 169. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M Channon and H. Watkins Coronary artery disease genetics: bigger is better Eur. Heart J., June 1, 2004; 25(11): 900 - 901. [Full Text] [PDF] |
||||
![]() |
Y. Murase, Y. Yamada, A. Hirashiki, S. Ichihara, H. Kanda, M. Watarai, F. Takatsu, T. Murohara, and M. Yokota Genetic risk and gene-environment interaction in coronary artery spasm in Japanese men and women Eur. Heart J., June 1, 2004; 25(11): 970 - 977. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. E. Wyche, S. S. Wang, K. K. Griendling, S. I. Dikalov, H. Austin, S. Rao, B. Fink, D. G. Harrison, and A. M. Zafari C242T CYBA Polymorphism of the NADPH Oxidase Is Associated With Reduced Respiratory Burst in Human Neutrophils Hypertension, June 1, 2004; 43(6): 1246 - 1251. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Matsunaga-Irie, T. Maruyama, Y. Yamamoto, Y. Motohashi, H. Hirose, A. Shimada, M. Murata, and T. Saruta Relation Between Development of Nephropathy and the p22phox C242T and Receptor for Advanced Glycation End Product G1704T Gene Polymorphisms in Type 2 Diabetic Patients Diabetes Care, February 1, 2004; 27(2): 303 - 307. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Paravicini, S. Chrissobolis, G. R. Drummond, and C. G. Sobey Increased NADPH-Oxidase Activity and Nox4 Expression During Chronic Hypertension Is Associated With Enhanced Cerebral Vasodilatation to NADPH In Vivo Stroke, February 1, 2004; 35(2): 584 - 589. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. D. Hodgkinson, B. A. Millward, and A. G. Demaine Association of the p22phox Component of NAD(P)H Oxidase With Susceptibility to Diabetic Nephropathy in Patients With Type 1 Diabetes Diabetes Care, November 1, 2003; 26(11): 3111 - 3115. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Hayaishi-Okano, Y. Yamasaki, Y. Kajimoto, K.'y. Sakamoto, K. Ohtoshi, N. Katakami, D. Kawamori, T. Miyatsuka, M. Hatazaki, Y. Hazama, et al. Association of NAD(P)H Oxidase p22 phox Gene Variation With Advanced Carotid Atherosclerosis in Japanese Type 2 Diabetes Diabetes Care, February 1, 2003; 26(2): 458 - 463. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Yamada, H. Izawa, S. Ichihara, F. Takatsu, H. Ishihara, H. Hirayama, T. Sone, M. Tanaka, and M. Yokota Prediction of the Risk of Myocardial Infarction from Polymorphisms in Candidate Genes N. Engl. J. Med., December 12, 2002; 347(24): 1916 - 1923. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Wolf, U. Panzer, S. Harendza, U. Wenzel, and R. A. K. Stahl No association between a genetic variant of the p22phox component of NAD(P)H oxidase and the incidence and progression of IgA nephropathy Nephrol. Dial. Transplant., August 1, 2002; 17(8): 1509 - 1512. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Paravicini, L. M. Gulluyan, G. J. Dusting, and G. R. Drummond Increased NADPH Oxidase Activity, gp91phox Expression, and Endothelium-Dependent Vasorelaxation During Neointima Formation in Rabbits Circ. Res., July 12, 2002; 91(1): 54 - 61. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Zalba, G. S. Jose, M. U. Moreno, M. A. Fortuno, A. Fortuno, F. J. Beaumont, and J. Diez Oxidative Stress in Arterial Hypertension: Role of NAD(P)H Oxidase Hypertension, December 1, 2001; 38(6): 1395 - 1399. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Zalba, G. S. Jose, F. J. Beaumont, M. A. Fortuno, A. Fortuno, and J. Diez Polymorphisms and Promoter Overactivity of the p22phox Gene in Vascular Smooth Muscle Cells From Spontaneously Hypertensive Rats Circ. Res., February 2, 2001; 88(2): 217 - 222. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. Whitehead and G. A. FitzGerald Twenty-First Century Phox: Not Yet Ready for Widespread Screening Circulation, January 2, 2001; 103(1): 7 - 9. [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2000 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |