(Circulation. 2000;102:35.)
© 2000 American Heart Association, Inc.
Clinical Investigation and Reports |
From the Cardiology Branch, National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, Md.
Correspondence to Arshed A. Quyyumi, MD, National Institutes of Health, Cardiology Branch, NHLBI, Bldg 10, Room 7B15, 10 Center Dr, MSC 1650, Bethesda, MD 20892-1650. E-mail quyyumia{at}gwgate.nhlbi.nih.gov
| Abstract |
|---|
|
|
|---|
Methods and ResultsIn 56 patients with atherosclerosis or its risk factors, we studied endothelium-dependent responses with acetylcholine and endothelium-independent function with sodium nitroprusside, before and after ACE inhibition with enalaprilat. Enalaprilat did not alter either resting coronary tone or vasodilation with sodium nitroprusside. However, it potentiated the coronary microvascular and epicardial responses with acetylcholine; coronary blood flow increased from 82±7 to 90±8 mL/min (P=0.05) after enalaprilat. Patients with depressed endothelial function (P<0.001) and those with ACE DD or ID genotypes (P=0.002) but not those homozygous for the I allele had the greatest improvement by multivariate analysis. Similarly, acetylcholine-mediated epicardial vasomotion improved in segments that initially constricted (endothelial dysfunction): from -10.1±1% to -1.4±2% (P<0.001) after enalaprilat. No augmentation was observed in segments that dilated (normal endothelial dysfunction) with acetylcholine. Patients with the D allele, hypercholesterolemia, and smokers (all P<0.05) had greater improvement.
ConclusionsAcute ACE inhibition improves coronary epicardial and microvascular endothelium-dependent vasomotion in patients with atherosclerosis or its risk factors who have endothelial dysfunction and presence of the D allele.
Key Words: atherosclerosis genes angiotensin acetylcholine coronary disease
| Introduction |
|---|
|
|
|---|
The contribution of genotype to the development of atherosclerosis is evident in the predisposing role of family history, independent of conventional risk factors. An increase in frequency of myocardial infarction in patients with the D allele of the insertion-deletion (I/D) polymorphism in the ACE gene provides 1 genetic predisposing factor.5 The ACE gene is located on chromosome 17, and the polymorphism is characterized by the presence (I) or absence (D) of a 287base-pair alu repeat within intron 16.6 Because the polymorphism is located in an intron, it is believed to be a neutral marker in strong linkage disequilibrium with 1 or more unknown functional variants located in or close to the ACE gene.7 8 Many studies, including a recent meta-analysis, have reported an association between the DD genotype and increased risks of developing coronary artery disease,9 10 11 though some have failed to confirm these findings.12 13 Since circulating14 and tissue ACE15 levels are higher in patients with the D allele, we hypothesized that ACE inhibition may result in a greater improvement in endothelial dysfunction in patients with the DD or ID genotypes compared with those with II genotype.
Thus, the aim of this study was to investigate whether in patients with atherosclerosis or its risk factors, acute ACE inhibition (1) improves coronary epicardial and microvascular endothelial function and (2) whether this improvement is related to the ACE I/D polymorphism or to serum ACE levels.
| Methods |
|---|
|
|
|---|
48 hours before the study, and
aspirin or other cyclo-oxygenase inhibitors
were discontinued 7 days before. The study was approved by the National
Heart, Lung, and Blood Institute Investigational Review Board, and
informed consent was obtained from all patients.
Fifty-six patients with atherosclerosis or its risk
factors were enrolled into the study; 33 patients had coronary
atherosclerosis and 23 had angiographically normal
coronary arteries and
1 risk factors for
atherosclerosis that included presence of hypertension
(blood pressure >140/90), hypercholesterolemia
(total cholesterol >220 mg/dL), noninsulin-dependent
diabetes, current smoking or smoking in the previous year, or age >60
years (Table 1
).
|
Protocol
After diagnostic coronary angiography, a 6F
guiding catheter was introduced into the proximal segment of either the
left main or the proximal segment of a major epicardial artery, and
blood flow velocity was measured with the use of a 0.018-inch wire
equipped with a Doppler crystal at its tip (Cardiometrics Flowire,
Cardiometrics, Inc).2 Flow measurements were made in a
coronary artery with <30% stenosis to ensure that
microvascular function could be measured. All drugs were infused
directly into the left main or the right coronary artery
through the guide catheter at rates ranging between 1 and 2 mL/min
(half in the right coronary artery).
Effect of Enalaprilat on Responses to Acetylcholine and Sodium
Nitroprusside
After a 5-minute infusion of 5% dextrose at 1 mL/min,
measurements of coronary blood flow velocity and
coronary angiography were performed and repeated after each
intervention. Endothelium-dependent vasodilation was
estimated by measuring coronary flow and epicardial responses
to incremental 2-minute infusions of intracoronary
acetylcholine (ACh) starting at
10-7 mol/L
(intracoronary concentration) in patients with
atherosclerosis and at
10-6 mol/L in patients
with normal coronary arteries. This was followed by infusions
of 10-6 mol/L ACh in
patients with atherosclerosis, so that all patients
received the higher dose of ACh.
Ten minutes after ACh measurements were performed, endothelium-independent function was estimated with intracoronary sodium nitroprusside given at 40 µg/min for 3 minutes, and flow reserve was measured with intracoronary adenosine administered at 2.2 mg/min for 2 minutes.
This was followed by a 10-minute intracoronary infusion of the ACE inhibitor enalaprilat (Merck) at 20 µg/min. We have previously demonstrated that this dose of enalaprilat effectively inhibits coronary vascular ACE because bradykinin responses were significantly enhanced.16 While continuing the infusion of enalaprilat at 20 µg/min, ACh was coinfused at 10-6 mol/L. Twenty-eight patients had repeat infusions of 40 µg/min sodium nitroprusside for 3 minutes.
Measurement of Coronary Blood Flow and Diameter
As previously described, coronary blood flow was derived
from the coronary blood flow velocity and diameter measurements
by use of the formula (
xaverage peak
velocityx0.125xdiameter).2 Coronary vascular
resistance was calculated as mean arterial pressure divided
by blood flow.2
In addition to the measurement of the diameter at the level of the Doppler flow wire, 0.25- to 0.5-cm segments of mid and distal regions of the epicardial coronary arteries were also measured by quantitative coronary angiography.
Determination of ACE Genotype
ACE genotyping was performed by laboratory personnel
who had no knowledge of the endothelial function data.
ACE genotypes were determined by use of polymerase
chain reaction, according to previously published
protocols.7 In brief, a set of primers was designed
to encompass the polymorphic region in intron 16 of the
ACE gene (sense primer 5' CTGGAGACCACTCCCATCCTTTCT 3' and
antisense primer 5' GATGTGGCCATCACATTCGTCAGAT 3'). DNA was amplified
for 35 cycles, each cycle composed of denaturation at 94°C for 30
seconds, annealing at 58°C for 30 seconds, and extension at 72°C
for 30 seconds. The products were separated by electrophoresis on
2% agarose gel and identified by ethidium bromide staining. To verify
the DD allele, each sample found to be DD was
reamplified with the primers hace5a and hace5c,
which recognize the inserted sequence, as previously
described.12 This amplification detected the presence
of the I allele and produced no product from the DNA
with DD genotype.
Statistical Analysis
Data are expressed as mean±SEM. Differences between means were
compared by paired or unpaired Students t test, as
appropriate. All probability values were 2-tailed, and a value <0.05
was considered statistically significant. Univariate
correlations were performed by use of Pearsons correlation
coefficient. Multiple stepwise regression analysis was
performed to test whether the magnitude of change with enalaprilat of
ACh-mediated vasodilation, measured as the decrease in coronary
vascular resistance with ACh, was related to the age, sex, presence of
atherosclerosis, hypertension, diabetes, cigarette use,
total cholesterol, HDL, serum ACE levels, plasma renin
activity, to the initial vasodilator response with ACh, or the
ACE I/D genotype. This was also performed for the
changes in the epicardial diameter with ACh after ACE inhibition.
| Results |
|---|
|
|
|---|
|
Effect of Enalaprilat on Response to ACh
After enalaprilat, ACh-induced vasodilation was enhanced. Thus,
compared with baseline, enalaprilat increased flow from 102±11% to
127±13% (P=0.008) and reduced coronary vascular
resistance, compared with baseline, from 42±3% to 49±3%
(P=0.002, Figure 1
).
|
The potentiation of ACh-mediated vasodilation with enalaprilat
correlated with the baseline vasodilator response to ACh
(r=0.44, P=0.006), indicating that patients with
a depressed response to ACh had greater improvement with enalaprilat
and vice versa. ACE inhibition also improved ACh-mediated
coronary epicardial vasomotion; the baseline -0.8±1% change
was improved to a 1.6±1.1% (P=0.034) dilation after
enalaprilat. As previously reported, coronary epicardial
changes with ACh were heterogenous.17
Because of this variability, we divided epicardial segments into those
that constricted with ACh (n=75, endothelial
dysfunction) and the remaining that dilated (n=71, normal
endothelial function) for studying the response of
enalaprilat. Improvement in epicardial coronary artery
vasomotion was only observed in segments with
endothelial dysfunction (-9.1±1% to -2.5±1.4%,
P<0.001), whereas segments that dilated with ACh had no
change with enalaprilat (7.9±0.9% to 6.5±1.5%, P=0.3,
Figure 1
).
Effect of Enalaprilat on Response to Sodium Nitroprusside
Microvascular (139±14% increase in coronary blood flow)
and epicardial (19±2%) dilation with sodium nitroprusside remained
unchanged after enalaprilat (158±15%, P=NS, and 19±1%,
P=NS, respectively, Figure 2
).
|
ACE Genotype and Coronary Vascular
Responses to Enalaprilat
The frequencies of the DD, ID, and II
genotypes (0.20, 0.57, and 0.23, respectively) did not deviate
significantly from those predicted by the Hardy-Weinberg equilibrium
(0.23, 0.5, 0.27:
2=1.49, P>0.1).
The distribution of risk factors for atherosclerosis,
plasma renin activity, and baseline hemodynamic
measurements were similar between the 3 groups of patients. As
expected, plasma ACE levels were higher in the DD group
compared with the II group (Table 1
).
Microvascular dilation with ACh was not significantly different among
the genotype subgroups (blood flow increased by 68±15%,
107±16%, and 117±23% in DD, ID, and II
genotypes, respectively, P=0.18, ANOVA, Figure 3
). Similarly, the mean diameter change
with ACh did not vary in patients with different genotypes
(DD -0.7±1.8%, ID -1±1.3%, and
II -0.5±2.2%; P=0.97, ANOVA).
|
The magnitude of enalaprilat-induced improvement in ACh-mediated
microvascular dilation, however, correlated with the ACE I/D
genotype (r=0.43, P=0.001). Significant
improvement was only observed in patients with the DD and
ID genotypes, who had a 20±10% (P=0.01)
and 18±8% (P<0.01) further increase in coronary
blood flow with enalaprilat, respectively, compared with a
nonsignificant 2±8% (P=0.8) decrease in flow in those
homozygous for the I allele (Figure 3
).
Because enalaprilat primarily improved epicardial reactivity only in
segments that constricted with ACh, the effect of the ACE
I/D genotype was examined in these segments. As in the
microcirculation, enalaprilat produced significant improvement only in
patients with the D allele in whom ACh-induced
constriction decreased from -9.4±1.4% to -2.1±1.7%
(P<0.001, Figure 4
). In
contrast, the change from -8.5±2.0% to -3.5±2.3%
(P=0.1) in patients with the II genotype
was insignificant (Figure 4
).
|
Serum ACE Levels and Coronary Vascular Responses to
Enalaprilat
Because serum ACE levels correlated with the ACE I/D
genotype (r=0.35, P=0.005, Table 1
), we investigated the relation between plasma ACE levels and
the effect of enalaprilat on ACh-mediated vasodilation. No significant
correlation was observed between serum ACE levels and either the
microvascular or epicardial coronary arterial
potentiation of the ACE response with enalaprilat. We divided patients
into 2 groups, based on the median value of 9.9±0.6 U/L (Figure 5
). Mean ACE levels in the 2 groups were
14.3±0.6 U/L (n=23) and 6.8±0.3 U/L (n=33), respectively. Baseline
vasodilator responses to ACh were similar between the groups
(P=0.25). After enalaprilat, ACh-mediated microvascular
dilation was enhanced in patients with high ACE levels
(P=0.004) but not in those with low ACE levels
(P=0.1, Figure 5
). In contrast to the
microcirculation, enalaprilat improved ACh-mediated epicardial vessel
constriction in patients with high (4±2% net gain,
P=0.004) and low ACE levels (4±2% gain,
P=0.005).
|
There was no association between plasma renin activity and either the baseline endothelial function or its improvement with enalaprilat.
Multivariate Analysis
The only statistically significant independent predictors of
improvement in ACh-mediated microvascular dilation with enalaprilat
were the baseline response to ACh (P<0.001) and the
presence of the D allele (P=0.002). Thus,
patients with DD and ID genotypes and
those with an initially depressed response to ACh had greater
improvement in microvascular dilation with enalaprilat. The interaction
between the ACE I/D polymorphism and baseline
microvascular endothelial function is illustrated in
Figure 6
.
|
Similar multivariate analysis for epicardial segments revealed that the only significant independent predictors of improvement in ACh-mediated epicardial coronary constriction with enalaprilat were the presence of D allele (P=0.009), serum cholesterol level (P=0.002), and cigarette smoking (P=0.015). Thus, constricting segments from patients with DD or ID genotypes, those with elevated cholesterol levels, and those with history of smoking were likely to improve most with enalaprilat.
| Discussion |
|---|
|
|
|---|
We have previously reported that the depression in epicardial and microvascular dilation in response to ACh in patients with risk factors for atherosclerosis is associated with reduced basal and stimulated NO activity.2 We revealed that acute ACE inhibition reverses coronary endothelial dysfunction, an effect that we have previously demonstrated to be due to improvement in vascular NO bioavailability.18 This beneficial action was greatest in patients with endothelial dysfunction; a depressed response to ACh in the microcirculation independently correlated with the magnitude of improvement of the ACh response with ACE inhibition. Similarly, segments with ACh-mediated constriction, considered to be a hallmark of endothelial dysfunction in the human epicardial circulation, improved with enalaprilat, and this improvement was greater in smokers and patients with hypercholesterolemia. In contrast, epicardial segments without endothelial dysfunction remained unchanged, indicating, as in the coronary microvasculature, that the action of ACE inhibitors is greatest in areas of endothelial dysfunction. Moreover, there was no change in resting coronary vascular tone or enhancement of endothelium-independent function with sodium nitroprusside after ACE inhibition, indicating that the benefit of enalaprilat was specifically due to its action on the vascular endothelium.
Our data are consistent with previous reports in patients with heart failure19 and diabetes4 in whom acute ACE inhibition also improved the forearm vascular responses to ACh and flow-mediated brachial artery vasodilation. Furthermore, our findings indicate that long-term therapy, as in the trial on reversing endothelial dysfunction (TREND) study,3 is not essential to improve impaired endothelial function and that the effects of ACE inhibitors are at least partly due to local effects on the coronary arteries and not due to other neurohormonal changes that may occur with long-term therapy. Our investigation extends findings obtained in the epicardial circulation in previous studies to the coronary microcirculation and illustrates that the magnitude of improvement relates to both the genotype and baseline endothelial function.
Mechanism of Action of ACE Inhibitors
Experimental studies suggest that ACE inhibitors
improve endothelial function by promoting release of
NO, prostaglandins, or endothelium-derived
hyperpolarizing factor.20 21 We have recently confirmed
that in humans the improvement in endothelial function
with ACE inhibition is also at least partly mediated through increased
NO activity.18
ACE inhibition may improve vascular NO activity by a reduction in angiotensin IIdependent vascular superoxide anion generation through the vascular NADH/NADPH oxidase system. Angiotensin II infusions produce endothelial dysfunction that can be restored toward normal with either superoxide dismutase or the receptor antagonist losartan.22 In a recent clinical study, we also demonstrated improvement in peripheral vascular endothelial dysfunction in patients with atherosclerosis after angiotensin AT-1 receptor blockade with losartan.23
Another potential mechanism whereby ACE inhibitors improve endothelial NO bioactivity is through an interaction with bradykinin. ACE, also known as kininase II, promotes degradation of bradykinin. Endogenous bradykinin appears to regulate resting coronary dilator tone and contributes to flow-mediated vasodilation of coronary and radial arteries in humans,24 suggesting that resting and stimulated increase in NO bioavailability may be due to local activity of bradykinin. Kinins vasodilate by releasing NO, prostanoids, and possibly endothelium-derived hyperpolarizing factor from the endothelium. Enhancement of bradykinin activity with ACE inhibition appears to be partially due to increased local levels but also due to augmentation of bradykinin binding to the receptor, reduction in B2 receptor desensitization, and internalization.25 Finally, we have demonstrated that enalaprilat, in the doses used in this study, improves bradykinin responses in the human coronary vasculature. Moreover, this is due to increased bioavailability of NO and leads to improved flow-mediated coronary vasomotion.16 18 Thus, it is likely that the improvement in endothelial dysfunction observed in patients with atherosclerosis is due in part to promotion of local bradykinin activity by ACE inhibition.
Mechanisms Underlying Improvement of
Endothelial Function in Patients With ACE
D Allele
Baseline vascular responses to ACh were similar in the 3
genotype groups, indicating that the presence of the
D allele does not determine muscarinic
receptorstimulated endothelial function, a finding
that we confirmed in a larger cohort and that has been previously
demonstrated in normal subjects with the use of flow-mediated brachial
artery dilation.26 27
Plasma ACE levels lack association with environmental
factors28 and are in part genetically determined, such
that the ACE I/D polymorphism accounts for
50% of
interindividual variability.14 Like plasma levels,
tissue ACE concentrations appear to be under genetic control. Left
ventricular ACE activity is higher in individuals with the
D allele,15 and conversion of
angiotensin II from angiotensin I is greater in
patients with the DD
genotype,29 30 indicating higher vascular
tissue ACE activity in the presence of the D allele.
Furthermore, upregulation of vascular ACE activity occurs in
atherosclerosis.31 Thus, over the
long term, this increased tissue ACE activity may augment the
deleterious effects of converting enzymeinduced
angiotensin II production and bradykinin breakdown,
and its inhibition would be expected to result in proportionately
greater benefit in individuals with the D allele. This
hypothesis is supported by our findings in which patients with the
D allele and higher ACE levels had greater improvement
in endothelial dysfunction after treatment with
enalaprilat. If these observations are confirmed in prospective trials,
it would serve to illustrate the importance of pharmacogenomics in
cardiovascular diseases.
Implications
In experimental models of atherosclerosis, ACE
inhibitors appear to have a protective
effect.32 These findings, together with our observations,
suggest that the improvement in NO activity by ACE
inhibitors may be antiatherogenic in the long term. The
impact of the ACE I/D polymorphism on the response to
ACE inhibitors warrants further investigation that may be
derived from ongoing trials currently in progress to evaluate the
long-term effects of converting enzyme inhibition on progression of
atherosclerosis and on clinical outcome.
| Acknowledgments |
|---|
Received October 18, 1999; revision received January 11, 2000; accepted February 2, 2000.
| References |
|---|
|
|
|---|
2. Quyyumi AA, Dakak N, Andrews NP, et al. Nitric oxide activity in the human coronary circulation. J Clin Invest. 1995;95:17471755.
3.
Mancini GBJ, Henry GC, Macaya C, et al.
Angiotensin-converting enzyme inhibition with quinapril
improves endothelial vasomotor dysfunction in patients
with coronary artery disease. Circulation. 1996;94:258265.
4. ODriscoll G, Green D, Rankin J, et al. Improvement in endothelial function by angiotensin converting enzyme inhibition in insulin-dependent diabetes mellitus. J Clin Invest. 1997;100:678684.[Medline] [Order article via Infotrieve]
5. Cambien F, Poirier O, Lecerf L, et al. Deletion polymorphism in the gene for angiotensin-converting enzyme is a potent risk factor for myocardial infarction. Nature. 1992;359:641644.[Medline] [Order article via Infotrieve]
6.
Villard E, Soubrier F. Molecular biology and genetics
of the angiotensin-I-converting enzyme: potential
implications in cardiovascular diseases.
Cardiovasc Res. 1996;32:9991007.
7. Tiret L, Rigat B, Visvikis S, et al. Evidence, from combined segregation and linkage analysis, that a variant of the angiotensin I-converting enzyme (ACE) gene controls plasma ACE levels. Am J Hum Genet. 1992;51:197205.[Medline] [Order article via Infotrieve]
8. Villard E, Tiret L, Visvikis S, et al. Identification of new polymorphisms of the angiotensin I-converting enzyme (ACE) gene, and study of their relationship to plasma ACE levels by 2-QTL segregation-linkage analysis. Am J Hum Genet. 1996;58:12681278.[Medline] [Order article via Infotrieve]
9.
Samani NJ, Thompson JR, OToole L, et al. A
meta-analysis of the association of the deletion allele of
the angiotensin converting enzyme gene with myocardial
infarction. Circulation. 1996;94:708712.
10.
Nakai K, Itoh C, Miura Y, et al. Deletion
polymorphism of the angiotensin I-converting enzyme
gene is associated with serum ACE concentration and increased risk for
CAD in the Japanese. Circulation. 1994;90:21992202.
11.
Mattu RK, Needham EW, Galton DJ, et al. A DNA variant
at the angiotensin-converting enzyme gene locus associates
with coronary artery disease in the Caerphilly Heart Study.
Circulation. 1995;91:270274.
12.
Lindpaintner K, Pfeffer MA, Kreutz R, et al. A
prospective evaluation of an angiotensin-converting-enzyme
gene polymorphism and the risk of ischemic heart disease.
N Engl J Med. 1995;332:706711.
13.
Agerholm-Larsen B, Nordestgaard BG, Steffensen R, et
al. ACE gene polymorphism: ischemic heart disease and
longevity in 10 150 individuals: a case-referent and retrospective
cohort study based on the Copenhagen City Heart Study.
Circulation. 1997;95:23582367.
14. Rigat B, Hubert C, Alhenc-Gelas F, et al. An insertion/deletion polymorphism in the angiotensin I-converting enzyme gene accounting for half the variance of serum enzyme levels. J Clin Invest. 1990;86:13431346.
15.
Danser AH, Schalekamp MA, Bax WA, et al.
Angiotensin-converting enzyme in the human heart: effect of
the deletion/insertion polymorphism. Circulation. 1995;92:13871388.
16.
Prasad A, Husain S, Quyyumi AA. Abnormal flow-mediated
epicardial vasomotion in human coronary arteries is improved by
angiotensin converting enzyme inhibition: a potential role
of bradykinin. J Am Coll Cardiol. 1999;33:796804.
17.
el-Tamimi H, Mansour M, Wargovich TJ, et al.
Constrictor and dilator responses to intracoronary
acetylcholine in adjacent segments of the same coronary artery
in patients with coronary artery disease:
endothelial function revisited. Circulation. 1994;89:4551.
18. Prasad A, Husain S, Quyyumi AA. Human peripheral endothelial dysfunction and nitric oxide bioavailability improves with angiotensin converting enzyme inhibition. Am J Cardiol. 1999;84:16.[Medline] [Order article via Infotrieve]
19. Nakamura M, Funakoshi T, Arakawa N, et al. Effect of angiotensin-converting enzyme inhibitors on endothelium-dependent peripheral vasodilation in patients with heart failure. J Am Coll Cardiol. 1994;24:13211327.[Abstract]
20.
Sudhir K, Chou TM, Hutchison SJ, et al.
Coronary vasodilation induced by
angiotensin-converting enzyme inhibition in vivo.
Circulation. 1996;93:17341739.
21. Nakashima M, Mombouli J-V, Taylor AA, et al. Endothelium-dependent hyperpolarization caused by bradykinin in human coronary arteries. J Clin Invest. 1993;92:28672871.
22. Rajagopalan S, Kurz S, Münzel T, et al. Angiotensin II-mediated hypertension in the rat increases vascular superoxide production via membrane NADH/NADPH oxidase activation. J Clin Invest. 1996;97:19161923.[Medline] [Order article via Infotrieve]
23.
Prasad A, Tupas-Habib T, Schenke WH, et al. Acute and
chronic angiotensin type 1 receptor antagonism reverses
endothelial dysfunction in
atherosclerosis. Circulation.. 2000;101:23492354.
24.
Groves P, Kurz S, Just H, et al. Role of
endogenous bradykinin in human coronary vasomotor
control. Circulation. 1995;92:34243430.
25.
Minshall RD, Tan F, Nakamura F, et al. Potentiation of
the actions of bradykinin by angiotensin I-converting
enzyme inhibitors: the role of expressed human bradykinin
B2 receptors and angiotensin
I-converting enzyme in CHO cells. Circ Res. 1997;81:848856.
26. Prasad A, Narayanan S, Epstein N, et al. The genetic control of coronary vasomotor tone: role of angiotensin converting enzyme gene polymorphism. J Am Coll Cardiol. 1999;33:312A. Abstract.
27. Celermajer DS, Sorensen KE, Barley J, et al. Angiotensin-converting enzyme genotype is not associated with endothelial dysfunction in subjects without other coronary risk factors. Atherosclerosis. 1994;111:121126.[Medline] [Order article via Infotrieve]
28. Alhenc-Gelas F, Richard J, Courbon D, et al. Distribution of plasma angiotensin I-converting enzyme levels in healthy men: relationship to environmental and hormonal parameters. J Lab Clin Med. 1991;117:3339.[Medline] [Order article via Infotrieve]
29.
Buikema H, Pinto YM, Rooks G, et al. The deletion
polymorphism of the angiotensin-converting enzyme gene
is related to phenotypic differences in human arteries. Eur
Heart J. 1996;17:787794.
30.
Ueda S, Elliott HL, Morton JJ, et al. Enhanced pressor
response to angiotensin I in normotensive men with the
deletion genotype (DD) for angiotensin-converting
enzyme. Hypertension. 1995;25:12661269.
31.
Diet F, Pratt RE, Berry GJ, et al. Increased
accumulation of tissue ACE in human atherosclerotic coronary
artery disease. Circulation. 1996;94:27562767.
32.
Powell JS, Clozel JP, Muller RKM, et al.
Inhibitors of angiotensin converting enzyme
prevent myointimal proliferation after vascular injury.
Science. 1989;245:186188.
This article has been cited by other articles:
![]() |
A. Hussein, D. Hilal, O. Hamoui, H. Hussein, L. Abouzahr, S. Kabbani, and E. Chammas Value of aortic arch analysis during routine transthoracic echocardiography in adults Eur J Echocardiogr, July 1, 2009; 10(5): 625 - 629. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Germing and A. Mugge What the cardiac surgeon needs to know prior to aortic valve surgery: impact of echocardiography Eur. J. Cardiothorac. Surg., June 1, 2009; 35(6): 960 - 964. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Khan, A. B. Sallehuddin, Z. R. Al-Bulbul, and Z. Y. Al-Halees Neoaortic Bicuspid Valve in Arterial Switch Operation: Mid-Term Follow-Up Ann. Thorac. Surg., January 1, 2008; 85(1): 179 - 184. [Abstract] [Full Text] [PDF] |
||||
![]() |
J Trevelyan, E W A Needham, A Morris, and R K Mattu Comparison of the effect of enalapril and losartan in conjunction with surgical coronary revascularisation versus revascularisation alone on systemic endothelial function Heart, August 1, 2005; 91(8): 1053 - 1057. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. De Cicco, R. Lorusso, A. Colli, F. Nicolini, C. Fragnito, T. Grimaldi, B. Borrello, A. M. Budillon, T. Gherli, and C. Beghi Aortic Valve Periprosthetic Leakage: Anatomic Observations and Surgical Results Ann. Thorac. Surg., May 1, 2005; 79(5): 1480 - 1485. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. G. Nabel Cardiovascular Disease N. Engl. J. Med., July 3, 2003; 349(1): 60 - 72. [Full Text] [PDF] |
||||
![]() |
W E Evans Pharmacogenomics: marshalling the human genome to individualise drug therapy Gut, May 1, 2003; 52(90002): ii10 - 18. [Abstract] [Full Text] |
||||
![]() |
X. Li, Y. Du, Y. Du, and X. Huang Correlation of Angiotensin-Converting Enzyme Gene Polymorphism with Effect of Antihypertensive Therapy by Angiotensin-Converting Enzyme Inhibitor Journal of Cardiovascular Pharmacology and Therapeutics, March 1, 2003; 8(1): 25 - 30. [Abstract] [PDF] |
||||
![]() |
W. E. Evans and H. L. McLeod Pharmacogenomics -- Drug Disposition, Drug Targets, and Side Effects N. Engl. J. Med., February 6, 2003; 348(6): 538 - 549. [Full Text] [PDF] |
||||
![]() |
P. O. Bonetti, L. O. Lerman, and A. Lerman Endothelial Dysfunction: A Marker of Atherosclerotic Risk Arterioscler. Thromb. Vasc. Biol., February 1, 2003; 23(2): 168 - 175. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. F. Russo, S. Mazzetti, A. Garatti, E. Ribera, A. Milazzo, G. Bruschi, M. Lanfranconi, T. Colombo, and E. Vitali Aortic complications after bicuspid aortic valve replacement: long-term results Ann. Thorac. Surg., November 1, 2002; 74(5): S1773 - 1776. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. F. Immer, H. Barmettler, P. A. Berdat, A. S. Immer-Bansi, L. Englberger, E. S. Krahenbuhl, and T. P. Carrel Effects of deep hypothermic circulatory arrest on outcome after resection of ascending aortic aneurysm Ann. Thorac. Surg., August 1, 2002; 74(2): 422 - 425. [Abstract] [Full Text] [PDF] |
||||
![]() |
B.-M. Taute, C. Glaser, R. Taute, and H. Podhaisky Progression of Atherosclerosis in Patients with Peripheral Arterial Disease as a Function of Angiotensin-Converting Enzyme Gene Insertion/Deletion Polymorphism Angiology, July 1, 2002; 53(4): 375 - 382. [Abstract] [PDF] |
||||
![]() |
A. Prasad, R. Mincemoyer, and A. A. Quyyumi Anti-ischemic effects of angiotensin- converting enzyme inhibition in hypertension J. Am. Coll. Cardiol., October 1, 2001; 38(4): 1116 - 1122. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. McNamara, R. Holubkov, K. Janosko, A. Palmer, J. J. Wang, G. A. MacGowan, S. Murali, W. D. Rosenblum, B. London, and A. M. Feldman Pharmacogenetic Interactions Between {beta}-Blocker Therapy and the Angiotensin-Converting Enzyme Deletion Polymorphism in Patients With Congestive Heart Failure Circulation, March 27, 2001; 103(12): 1644 - 1648. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. H. McDermott, J. P.J. Halcox, W. H. Schenke, M. A. Waclawiw, M. N. Merrell, N. Epstein, A. A. Quyyumi, and P. M. Murphy Association Between Polymorphism in the Chemokine Receptor CX3CR1 and Coronary Vascular Endothelial Dysfunction and Atherosclerosis Circ. Res., August 31, 2001; 89(5): 401 - 407. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2000 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |