(Circulation. 2000;101:2883.)
© 2000 American Heart Association, Inc.
Clinical Investigation and Reports |
From the Department of Medicine, Division of Rheumatology (G.L., J.J.G., H.Y., C.M.W.) and Division of Cardiovascular Diseases (G.L., S.L.K., D.R.H., R.L.F.), Mayo Clinic and Foundation, Rochester, Minn.
Correspondence to C.M. Weyand, MD, PhD, Mayo Clinic and Foundation, 200 First St SW, Rochester, MN 55905. E-mail weyand.cornelia{at}mayo.edu
| Abstract |
|---|
|
|
|---|
producing T lymphocytes. The cause of T-cell activation
and the precise role of activated T cells in plaque instability
are not understood. Methods and ResultsPeripheral blood T cells from 34 patients with stable angina and 34 patients with UA were compared for the distribution of functional T-cell subsets by flow cytometric analysis. Clonality within the T-cell compartment was identified by T-cell receptor spectrotyping and subsequent sequencing. Tissue-infiltrating T cells were examined in extracts from coronary arteries containing stable or unstable plaque. The subset of CD4+CD28null T cells was expanded in patients with UA and infrequent in patients with stable angina (median frequencies: 10.8% versus 1.5%, P<0.001). CD4+CD28null T cells included a large monoclonal population, with 59 clonotypes isolated from 20 UA patients. T-cell clonotypes from different UA patients used antigen receptors with similar sequences. T-cell receptor sequences derived from monoclonal T-cell populations were detected in the culprit but not in the nonculprit lesion of a patient with fatal myocardial infarction.
ConclusionsUA is associated with the emergence of monoclonal T-cell populations, analogous to monoclonal gammopathy of unknown significance. Shared T-cell receptor sequences in clonotypes of different patients implicate chronic stimulation by a common antigen, for example, persistent infection. The unstable plaque but not the stable plaque is invaded by clonally expanded T cells, suggesting a direct involvement of these lymphocytes in plaque disruption.
Key Words: angina plaque lymphocytes cytokines immune system
| Introduction |
|---|
|
|
|---|
We recently reported that monocyte activation in UA
represents a downstream effect of an altered T-cell response
characterized by the preferential production of interferon-
(IFN-
). IFN-
producing T cells in the peripheral
blood were more frequent in patients with UA than in patients with SA.
IFN-
was derived from an unusual subset of
CD4+ T cells,
CD4+CD28null T cells, which
was expanded in UA patients.17 An understanding of the
pathophysiology of
CD4+CD28null T cells and
the mechanisms leading to their expansion may provide insights into the
cause of ACS and into the roles played by T cells and
macrophages in plaque rupture.
| Methods |
|---|
|
|
|---|
Flow Cytometry
PBMCs were stained with phycoerythrin-conjugated anti-CD4
(Becton Dickinson) and FITC-conjugated anti-CD28 (Pharmingen)
monoclonal antibodies and analyzed on a FACSCalibur flow
cytometer (Becton Dickinson). The frequencies of
CD4+CD28+ and
CD4+CD28null T cells were
determined with the use of WinMDI software (Joseph Trotter, Scripps
Research Institute).
T-Cell Receptor ß-Chain Sequence Analysis of
Peripheral T Cells
CD4+CD28+ and
CD4+CD28null T cells were
purified from PBMCs by cell sorting on a FACSVantage flow cytometer.
Total RNA of 1x105
CD4+CD28+ and
CD4+CD28null cells was
extracted (Trizol, Life Technologies), and cDNA was amplified with
primers specific for BV2, BV3, BV5S2, BV6, BV7, BV8, BV13S1, BV14,
BV17, and BV18 and a BC-specific primer, as
described.18 19 The BV families analyzed were
chosen arbitrarily to cover
50% of the total T-cell receptor (TCR)
repertoire. Amplified products were labeled with the use of a
primer extension assay with the appropriate end-labeled BC primer and
were separated on a 5% denaturing polyacrylamide
gel.18 Band intensities were analyzed to determine
whether the distribution was gaussian, indicating polyclonality, or
skewed by dominant bands, indicating clonal expansion. In previous
studies, bands with intensities greater than the sum of 2 adjacent
bands and accounting for
30% of the total product were
predictive of clonality.18 Dominant bands were directly
sequenced by automated sequencing (ABI Prism Sequence Detection System,
Perkin Elmer Applied Biosystems).
TCR ß-Chain Sequence Analysis of Tissue-Infiltrating
T Cells
We obtained coronary artery specimens from the left
anterior descending artery and the right coronary artery of a
patient with a fatal myocardial infarction in the territory of the
right coronary artery. Arterial fragments were
confirmed by histology to contain stable and unstable plaques, and
total RNA was extracted from the appropriate segments. A second sample
with a fissured plaque was obtained from a patient undergoing
atherectomy. TCR ß-chainspecific cDNA was synthesized with the use
of a BC antisense primer (CTGTGCACCTCCTTCCCATTC) and amplified with the
use of BV-specific primers and a nested set of BC primers
(GTGGGAGATCTCTGCTTCTG, TTCTGATGGCTCAAACAC) and then sequenced.
Statistical Analysis
We used the Mann-Whitney U test (SigmaStat, SPSS) to
compare the frequencies of
CD4+CD28null T cells in the
patients with SA and UA.
| Results |
|---|
|
|
|---|
10-fold in our cohort of 34 UA
patients (median 10.8%, P<0.001).
|
To explore the possibility that
CD4+CD28null T cells in the
UA patients were expanded in response to a defined stimulus, such as an
antigen, we examined the diversity of T-cell antigen receptors.
CD4+ T cells from 20 patients with UA were sorted
into CD4+CD28+ and
CD4+CD28null
subpopulations, and TCR transcripts were amplified with BV- and
BC-specific primer sets and fractionated on polyacrylamide
gels. For CD4+CD28+ T
cells, length classes of TCR transcripts followed a gaussian
distribution characteristic of polyclonal T-cell
populations.18 In contrast, transcripts from
CD4+CD28null T cells
frequently deviated from a gaussian distribution, with dominant bands
suggestive of clonal populations (Figure 2
). Seventy-two dominant bands were
sequenced from these 20 patients, 59 of which yielded unequivocal
sequences, confirming the presence of clonal T-cell populations. An
average of 3 T-cell clones was seen in UA patients (range 0 to 11).
Interestingly, the one patient who lacked clonal TCR sequences also had
a lower frequency of
CD4+CD28null T cells. The
primer sets used covered
50% of the CD4+
T-cell repertoire. Patients with unstable angina can therefore be
estimated to carry an average of 6 clonally expanded
CD4+ T cells in the repertoire. Comparison of
clinical parameters between patients with low and high
numbers of T-cell clonotypes demonstrated no features correlating with
the extent of oligoclonality (data not shown). Individual T-cell clones
differed in size, with large clones reaching 5% and small clones
accounting for 0.5% of the circulating CD4+
T-cell pool.
|
Persistence of Expanded CD4+CD28null
Clonotypes
We have previously shown that the frequencies of
CD4+CD28null T cells are
stable over time.17 To examine whether clonal outgrowth
was a transient event related to acute disease, we analyzed
peripheral blood
CD4+CD28null T cells from 5
patients with UA 6 months after the initial study. As shown in Figure 3
, clonal dominance of selected T cells
in the CD4+CD28null T-cell
compartment was maintained for the majority of expanded clonotypes (16
of 18). Clonal identity was confirmed by sequencing.
|
Sharing of TCR Sequences in Expanded
CD4+CD28null Clonotypes From Multiple
Patients
Comparative analysis of TCR sequences expressed by
expanded clonotypes can provide information about the stimulus driving
the outgrowth of these T cells. A finding of structurally similar TCRs
in multiple patients with UA would indicate exposure of these patients
to the same antigen(s). The 59 clonal TCR sequences were
analyzed for the use of TCR-BV and TCR-BJ gene elements (Figure 4
). The distribution of BV gene segments
from clonally expanded T cells was different from that of unselected
T-cell populations, with BV3S1/S2 the BV element most common by far,
accounting for 24% of all expanded clonotypes (compared with an
expected 5% in a random sample). In addition, BV14S1 and BV8S1/S2 were
encountered frequently, whereas BV17 and BV6S2/S3 were found in only a
small proportion of clonal T cells. Nonrandom use of TCR gene segments
was even more pronounced for BJ genes. More than 35% of the TCR
sequences included a rearranged BJ2S1 gene, 22% a BJ2S7 gene, and 15%
a BJ2S3 gene. BJ2S2 and BJ2S5 gene segments were not found, and BJ
genes of the BJ1 family were explicitly infrequent. The BV3S1/S2-BJ2S1
TCR gene segment combination accounted for 11% of TCR sequences,
compared with an expected 1% in a random T-cell population.
|
The structure of the TCR that directly contacts the antigenic peptide
is the junctional N-D-N region at the interface of TCR-BV and TCR-BJ
gene segments. To further investigate the hypothesis that antigen
recognition underlies clonal expansion, we compared
nucleotide and amino acid sequences of the junctional
region of expanded clonotypes. Receptor homology was defined as
the sharing of
60% of all amino acids. Among the 59 TCR sequences,
similarities were seen in 10 sequences derived from 7 patients (Table 1
). One patient carried 2
clonotypes and another had 3 clonotypes that expressed N-D-N sequences
very similar to those identified in other UA patients. The group of
related TCR sequences included 3 receptors of the
overrepresented of BV3S1/S2-BJ2S1 rearrangement. All TCR
sequences with shared amino acid sequences displayed
heterogeneity at the level of nucleotide
sequences.
|
CD4+CD28null Expanded Clonotypes Infiltrate
Unstable Plaque
If CD4+CD28null
clonotypes respond to antigenic stimulation and are involved in
precipitating acute ischemic complications, they should be
present in the arterial wall. Culprit and nonculprit
lesions of postmortem coronary specimens were examined for the
representation of TCR sequences, and TCR transcripts in the
tissue specimens were amplified and sequenced. As shown in Figure 5
, coronary artery tissue with a
stable plaque was free of tissue-infiltrating T cells, whereas the
arterial wall segment of the lesion that caused the fatal
myocardial infarction did produce a signal. In this patients
peripheral blood,
CD4+CD28null T cells were
highly expanded and included 5 clonal TCR sequences (Table 2
). Two of these 5 sequences, from a
BV3+ and a BV8+ clone, were
also retrieved from the tissue where they had reached dominance. An
additional clonal BV14+ TCR sequence was found in
the coronary specimen, but it was distinct from the expanded
BV14+ clones in the periphery.
BV2+ T cells in the tissue displayed polyclonal
receptors. Similar results were obtained for a second patient who
underwent atherectomy of an unstable plaque. The plaque contained 2
clonal T-cell populations with receptor sequences corresponding to
those found in his peripheral
CD4+CD28null T cells (Table 3
).
|
|
|
| Discussion |
|---|
|
|
|---|
Diversity of the TCR repertoire is a fundamental principle of the immune system, and mechanisms that maintain diversity are critical in sustaining immunocompetence. In response to antigen, T cells proliferate and expand clonally. Clonal expansion of antigen-specific T cells is pivotal for a successful immune response but must be transient. Mechanisms are in place to prevent outgrowth of individual clones, limit T-cell proliferation, and induce clonal downsizing. Persistent clonal expansion is therefore a significant finding and may indicate defects in mechanisms of clonal downsizing. Evidence for defects in apoptotic pathways has been provided for CD4+CD28null T cells.22 The reduced propensity of CD4+CD28null T cells for apoptosis has been associated with overexpression of the survival protein bcl-2, which suggests that these T cells might have developed properties that allow their escape from normal pathways of clonal downsizing.22
Alternatively, long-term stimulation with antigen could cause the expansion and persistence of clonal CD4+ populations. This interpretation is suggested by the high degree of similarity in the amino acid sequence of TCR ß-chains from clonotypes of several patients. Obvious candidate antigens are microbial proteins, such as bacterial or viral products. Several recent lines of evidence have suggested a role for chronic infection in the pathogenesis of ACS.23 24 25 26 Although proof for a direct involvement of such infectious organisms in plaque inflammation is missing, persistent Chlamydia pneumoniae, Helicobacter pylori, or cytomegalovirus infections are suspected to have a role in the manifestations of coronary artery disease.23 24 25 26 Intracellular pathogens might conceivably survive in macrophages and reach immunogenicity in the atherosclerotic plaque. Alternatively, these cells could recognize self-antigens that become immunogenic in the atherosclerotic plaque. Interestingly, CD4+CD28null T-cell clones isolated from patients with vascular complications of rheumatoid arthritis have been shown to react to adherent cells, suggesting, as one possibility, a defect in self-tolerance.27 TCR sequences used by expanded clonotypes in patients with rheumatoid arthritis do not display similarities to those isolated from UA patients, indicating the relevance of different antigenic systems in these two syndromes.28
One of the important results of our study is the demonstration of clonally expanded T cells in the unstable atherosclerotic plaques of a patient who died of a myocardial infarction and a patient who underwent atherectomy. In the first patient, a large plaque present in the left anterior descending coronary artery was not involved in inducing acute coronary ischemia and therefore served as the optimal control. Of 5 CD4+CD28null T-cell clones isolated from the peripheral blood, 2 clones were detected in the culprit lesion but not in the control lesion. Our data cannot exclude that the accumulation of these cells is a secondary event; however, the presence of only 2 of the 5 circulating clonotypes in the tissue indicated that recruitment of these clones was not random but selective.
CD4+CD28null T cells may
display functional activities important for a patients predisposition
to vascular injury. Patients with rheumatoid arthritis in whom
CD4+CD28null T cells are
expanded are at high risk for the development of vasculitic
complications.29 In patients with UA, these cells may
directly contribute to plaque instability.
CD4+CD28null T cells are
characterized by their ability to produce high levels of
IFN-
.30 We have previously proposed that the increased
acute-phase response in UA patients is a downstream effect of excessive
IFN-
production. Because IFN-
is a potent stimulator of
macrophages, its presence in the local microenvironment of the
plaque could stimulate tissue-infiltrating macrophages to
produce tissue-destructive metalloproteinases. Other macrophage
functions with roles in tissue damage (such as release of toxic oxygen
radicals) also could result from local IFN-
stimulation.31 32 33 Equally important,
CD4+CD28null T cells are
distinguished from classic T-helper cells by their ability to function
as cytotoxic effector cells.34 Smooth muscle cells are
possible targets in the plaque. A loss of cap thickness has been shown
to identify plaques at risk for rupture.3
In conclusion, our data support the model that T-cell immunoresponsiveness influences a patients risk for the development of an ACS. Increased understanding of the generation of unusual T cells characterized by oligoclonality, longevity, a defect in clonal downsizing, cytolytic capability, and selective tissue invasion may provide clues as to whether stimulation of the immune system by micro-organisms contributes to UA. The interaction of T cells with their antigen is highly specific, and CD4+CD28null T cells isolated from these patients could be used to identify the driving antigen(s). Analysis of the molecular mechanisms regulating the transmigration and activation of these T cells, along with their interaction with other cell types in the atheroma, might be useful in identifying therapeutic targets.
| Acknowledgments |
|---|
Received September 17, 1999; revision received January 11, 2000; accepted February 1, 2000.
| References |
|---|
|
|
|---|
2.
Buja LM, Willerson JT. Role of inflammation in
coronary plaque disruption. Circulation. 1994;89:503505.
3.
Libby P. Molecular bases of the acute coronary
syndromes. Circulation.. 1995;91:28442850.
4. Hansson GK, Holm J, Jonasson L. Detection of activated T lymphocytes in the human atherosclerotic plaque. Am J Pathol. 1989;135:169175.[Abstract]
5.
Moreno PR, Falk E, Palacios IF, et al.
Macrophage infiltration in acute coronary syndromes:
implications for plaque rupture. Circulation.. 1994;90:775778.
6.
van der Wal AC, Becker AE, van der Loos CM, et al.
Site of intimal rupture or erosion of thrombosed coronary
atherosclerotic plaques is characterized by an inflammatory process
irrespective of the dominant plaque morphology. Circulation.. 1994;89:3644.
7.
Kovanen PT, Kaartinen M, Paavonen T. Infiltrates of
activated mast cells at the site of coronary
atheromatous erosion or rupture in myocardial
infarction. Circulation.. 1995;92:10841088.
8. Gallis Z, Sukhova G, Lark M, et al. Increased expression of matrix metalloproteinases and matrix degrading activity in vulnerable regions of human atherosclerotic plaques. J Clin Invest. 1994;94:24932503.
9.
Moreno PR, Bernardi VH, López-Cuéllar J,
et al. Macrophages, smooth muscle cells, and tissue factor in
unstable angina: implication for cell-mediated thrombogenicity in acute
coronary syndromes. Circulation. 1996;94:30903097.
10.
Serneri GG, Abbate R, Gori AM, et al. Transient
intermittent lymphocyte activation is responsible for the instability
of angina. Circulation. 1992;86:790797.
11.
Neri Serneri GG, Prisco D, Martini F, et al. Acute
T-cell activation is detectable in unstable angina.
Circulation.. 1997;95:18061812.
12.
Mazzone A, De Servi S, Mazzucchelli I, et al. Increased
expression of neutrophil and monocyte adhesion molecules in unstable
coronary artery disease. Circulation. 1993;88:358363.
13.
Jude B, Agraou B, McFadden EP, et al. Evidence for
time-dependent activation of monocytes in the systemic circulation in
unstable angina but not in acute myocardial infarction or in stable
angina. Circulation.. 1994;90:16621668.
14.
Liuzzo G, Biasucci LM, Gallimore JR, et al. The
prognostic value of C-reactive protein and serum amyloid A protein in
severe unstable angina. N Engl J Med. 1994;331:417424.
15.
Biasucci LM, Vitelli A, Liuzzo G, et al. Elevated
levels of interleukin-6 in unstable angina. Circulation. 1996;94:874877.
16. Haverkate F, Thompson SG, Pyke DM, et al. Production of C-reactive protein and risk of coronary events in stable and unstable angina. Lancet. 1997;349:462466.[Medline] [Order article via Infotrieve]
17.
Liuzzo G, Kopecky SL, Frye RL, et al.
Perturbation of the T cell repertoire in patients with unstable angina.
Circulation. 1999;100:21352139.
18. Waase I, Kayser C, Carlson PJ, et al. Oligoclonal T cell proliferation in patients with rheumatoid arthritis and their unaffected siblings. Arthritis Rheum.. 1006;39:904913.[Medline] [Order article via Infotrieve]
19.
Choi Y, Kotzin B, Heron L, et al. Interaction of
Staphylococcus aureus toxin "superantigens" with human T cells.
Proc Natl Acad Sci U S A. 1989;86:89418945.
20. Linsley P, Ledbetter J. The role of the CD28 receptor during T cell responses to antigen. Annu Rev Immunol. 1993;11:191212.[Medline] [Order article via Infotrieve]
21. Weyand CM, Brandes JC, Schmidt D, et al. Functional properties of CD4+CD28- T cells in the aging immune system. Mech Ageing Dev. 1998;102:131147.[Medline] [Order article via Infotrieve]
22.
Schirmer M, Vallejo AN, Weyand CM, et al. Resistance to
apoptosis and elevated expression of Bcl-2 in clonally expanded
CD4+CD28- T cells from
rheumatoid arthritis patients. J Immunol. 1998;161:10181025.
23.
Libby P, Egan D, Skarlatos S. Roles of infectious
agents in atherosclerosis and restenosis: an
assessment of the evidence and need for future research.
Circulation. 1997;96:40954103.
24. Danesh J, Collins R, Peto R. Chronic infections and coronary heart disease: is there a link? Lancet. 1997;350:430436.[Medline] [Order article via Infotrieve]
25.
Gupta S, Leatham EW, Carrington D, et al. Elevated
Chlamydia pneumoniae antibodies,
cardiovascular events, and azithromycin in male
survivors of myocardial infarction. Circulation. 1997;96:404407.
26. Gurfinkel E, Bozovich G, Daroca A, et al. Randomised trial of roxithromycin in non-Q-wave coronary syndromes: ROXIS Pilot Study: ROXIS Study Group. Lancet.. 1997;350:404407.[Medline] [Order article via Infotrieve]
27. Schmidt D, Goronzy JJ, Weyand CM. CD4+ CD7- CD28- T cells are expanded in rheumatoid arthritis and are characterized by autoreactivity. J Clin Invest. 1996;97:20272037.[Medline] [Order article via Infotrieve]
28. Schmidt D, Martens PB, Weyand CM, et al. The repertoire of CD4+CD28- T cells in rheumatoid arthritis. Mol Med. 1996;2:608618.[Medline] [Order article via Infotrieve]
29. Martens PB, Goronzy JJ, Schaid DJ, et al. Expansion of unusual CD4+ T cells in severe rheumatoid arthritis. Arthritis Rheum. 1997;40:11061114.[Medline] [Order article via Infotrieve]
30. Park W, Weyand CM, Schmidt D, et al. Costimulatory pathways controlling activation and peripheral tolerance of human CD4+CD28- T cells. Eur J Immunol. 1997;27:10821090.[Medline] [Order article via Infotrieve]
31.
Boehm U, Klamp T, Groot M, et al. Cellular responses to
interferon-
. Annu Rev Immunol. 1997;15:749795.[Medline]
[Order article via Infotrieve]
32. Zhou X, Stemme S, Hansson GK. Evidence for a local immune response in atherosclerosis. CD4+ T cells infiltrate lesions of ApoE-deficient mice. Am J Pathol. 1996;149:359366.[Abstract]
33. Gupta S, Pablo AM, Jiang X, et al. IFN-gamma potentiates atherosclerosis in ApoE knock-out mice. J Clin Invest. 1997;99:27522761.[Medline] [Order article via Infotrieve]
34. Namekawa T, Wagner UG, Goronzy JJ, et al. Functional subsets of CD4 T cells in rheumatoid synovitis. Arthritis Rheum. 1998;41:21082116.[Medline] [Order article via Infotrieve]
This article has been cited by other articles:
![]() |
I. E. Dumitriu, E. T. Araguas, C. Baboonian, and J. C. Kaski CD4+CD28null T cells in coronary artery disease: when helpers become killers Cardiovasc Res, January 1, 2009; 81(1): 11 - 19. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Studer, M. P. George, X. Zhu, Y. Song, V. G. Valentine, M. W. Stoner, J. Sethi, C. Steele, and S. R. Duncan CD28 Down-Regulation on CD4 T Cells Is a Marker for Graft Dysfunction in Lung Transplant Recipients Am. J. Respir. Crit. Care Med., October 1, 2008; 178(7): 765 - 773. [Abstract] [Full Text] [PDF] |
||||
![]() |
S Stojanov, C Dejaco, P Lohse, K Huss, C Duftner, B H Belohradsky, M Herold, and M Schirmer Clinical and functional characterisation of a novel TNFRSF1A c.605T>A/V173D cleavage site mutation associated with tumour necrosis factor receptor-associated periodic fever syndrome (TRAPS), cardiovascular complications and excellent response to etanercept treatment Ann Rheum Dis, September 1, 2008; 67(9): 1292 - 1298. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. I. van Leuven, R. Franssen, J. J. Kastelein, M. Levi, E. S. G. Stroes, and P. P. Tak Systemic inflammation as a risk factor for atherothrombosis Rheumatology, January 1, 2008; 47(1): 3 - 7. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. G. H. Betjes, N. H. R. Litjens, and R. Zietse Seropositivity for cytomegalovirus in patients with end-stage renal disease is strongly associated with atherosclerotic disease Nephrol. Dial. Transplant., November 1, 2007; 22(11): 3298 - 3303. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Liuzzo, L. M. Biasucci, G. Trotta, S. Brugaletta, M. Pinnelli, G. Digianuario, V. Rizzello, A. G. Rebuzzi, C. Rumi, A. Maseri, et al. Unusual CD4+CD28null T Lymphocytes and Recurrence of Acute Coronary Events J. Am. Coll. Cardiol., October 9, 2007; 50(15): 1450 - 1458. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Aukrust, A. Yndestad, W. J. Sandberg, L. Gullestad, and J. K. Damas T Cells in Coronary Artery Disease: Different Effects of Different T-Cell Subsets J. Am. Coll. Cardiol., October 9, 2007; 50(15): 1459 - 1461. [Full Text] [PDF] |
||||
![]() |
F. Del Porto, B. Lagana, S. Lai, I. Nofroni, F. Tinti, M. Vitale, E. Podesta, A. P. Mitterhofer, and R. D'Amelio Response to anti-tumour necrosis factor alpha blockade is associated with reduction of carotid intima-media thickness in patients with active rheumatoid arthritis Rheumatology, July 1, 2007; 46(7): 1111 - 1115. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. K. Ray, D. A. Morrow, M. S. Sabatine, A. Shui, N. Rifai, C. P. Cannon, and E. Braunwald Long-Term Prognostic Value of Neopterin: A Novel Marker of Monocyte Activation in Patients With Acute Coronary Syndrome Circulation, June 19, 2007; 115(24): 3071 - 3078. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. T H Jacobsson, C. Turesson, J.-A. Nilsson, I. F Petersson, E. Lindqvist, T. Saxne, and P. Geborek Treatment with TNF blockers and mortality risk in patients with rheumatoid arthritis Ann Rheum Dis, May 1, 2007; 66(5): 670 - 675. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. D. Wu, M. S. Maurer, R. A. Friedman, C. C. Marboe, E. M. Ruiz-Vazquez, R. Ramakrishnan, A. Schwartz, M. D. Tilson, A. S. Stewart, and R. Winchester The Lymphocytic Infiltration in Calcific Aortic Stenosis Predominantly Consists of Clonally Expanded T Cells J. Immunol., April 15, 2007; 178(8): 5329 - 5339. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Zal, C. Baboonian, and J. C. Kaski Letter to the Editor: Autoreactive CD4+CD28- T Cells and Acute Coronary Syndromes Arterioscler Thromb Vasc Biol, March 1, 2007; 27(3): E18 - E18. [Full Text] [PDF] |
||||
![]() |
A.-K. L. Robertson and G. K. Hansson Letter to the Editor: Autoreactive CD4+CD28- T Cells and Acute Coronary Syndromes Arterioscler Thromb Vasc Biol, March 1, 2007; 27(3): E19 - E19. [Full Text] [PDF] |
||||
![]() |
H. Ranjbaran, S. I. Sokol, A. Gallo, R. E. Eid, A. O. Iakimov, A. D'Alessio, J. R. Kapoor, S. Akhtar, C. J. Howes, M. Aslan, et al. An Inflammatory Pathway of IFN-{gamma} Production in Coronary Atherosclerosis J. Immunol., January 1, 2007; 178(1): 592 - 604. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Niessner, K. Sato, E. L. Chaikof, I. Colmegna, J. J. Goronzy, and C. M. Weyand Pathogen-Sensing Plasmacytoid Dendritic Cells Stimulate Cytotoxic T-Cell Function in the Atherosclerotic Plaque Through Interferon-{alpha} Circulation, December 5, 2006; 114(23): 2482 - 2489. [Abstract] [Full Text] [PDF] |
||||
![]() |
A.-K. L. Robertson and G. K Hansson T Cells in Atherogenesis: For Better or For Worse? Arterioscler Thromb Vasc Biol, November 1, 2006; 26(11): 2421 - 2432. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Goronzy and C. M. Weyand Immunosuppression in Atherosclerosis: Mobilizing the Opposition Within Circulation, October 31, 2006; 114(18): 1901 - 1904. [Full Text] [PDF] |
||||
![]() |
N. A. Flavahan A Farewell Kiss Triggers a Broken Heart? Circ. Res., May 12, 2006; 98(9): 1117 - 1119. [Full Text] [PDF] |
||||
![]() |
S. Pryshchep, K. Sato, J. J. Goronzy, and C. M. Weyand T Cell Recognition and Killing of Vascular Smooth Muscle Cells in Acute Coronary Syndrome Circ. Res., May 12, 2006; 98(9): 1168 - 1176. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. W. Raines Antigen-Independent Targeting of Long-Lived CD4+ Cytolytic T Effector Cells to Lesions of Atherosclerosis Circ. Res., March 3, 2006; 98(4): 434 - 436. [Full Text] [PDF] |
||||
![]() |
X. Zhang, A. Niessner, T. Nakajima, W. Ma-Krupa, S. L. Kopecky, R. L. Frye, J. J. Goronzy, and C. M. Weyand Interleukin 12 Induces T-Cell Recruitment Into the Atherosclerotic Plaque Circ. Res., March 3, 2006; 98(4): 524 - 531. [Abstract] [Full Text] [PDF] |
||||
![]() |
K M J Douglas, A V Pace, G J Treharne, A Saratzis, P Nightingale, N Erb, M J Banks, and G D Kitas Excess recurrent cardiac events in rheumatoid arthritis patients with acute coronary syndrome Ann Rheum Dis, March 1, 2006; 65(3): 348 - 353. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. De Palma, F. Del Galdo, G. Abbate, M. Chiariello, R. Calabro, L. Forte, G. Cimmino, M. F. Papa, M. G. Russo, G. Ambrosio, et al. Patients With Acute Coronary Syndrome Show Oligoclonal T-Cell Recruitment Within Unstable Plaque: Evidence for a Local, Intracoronary Immunologic Mechanism Circulation, February 7, 2006; 113(5): 640 - 646. [Abstract] [Full Text] [PDF] |
||||
![]() |
S Brugaletta, L M Biasucci, M Pinnelli, G Biondi-Zoccai, G Di Giannuario, G Trotta, G Liuzzo, and F Crea Novel anti-inflammatory effect of statins: reduction of CD4+CD28null T lymphocyte frequency in patients with unstable angina Heart, February 1, 2006; 92(2): 249 - 250. [Full Text] [PDF] |
||||
![]() |
K. Sato, A. Niessner, S. L. Kopecky, R. L. Frye, J. J. Goronzy, and C. M. Weyand TRAIL-expressing T cells induce apoptosis of vascular smooth muscle cells in the atherosclerotic plaque J. Exp. Med., January 23, 2006; 203(1): 239 - 250. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. C. Hall and N. Dalbeth Disease modification and cardiovascular risk reduction: two sides of the same coin? Rheumatology, December 1, 2005; 44(12): 1473 - 1482. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. N. Bruce 'Not only...but also': factors that contribute to accelerated atherosclerosis and premature coronary heart disease in systemic lupus erythematosus Rheumatology, December 1, 2005; 44(12): 1492 - 1502. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Shoenfeld, R. Gerli, A. Doria, E. Matsuura, M. M. Cerinic, N. Ronda, L. J. Jara, M. Abu-Shakra, P. L. Meroni, and Y. Sherer Accelerated Atherosclerosis in Autoimmune Rheumatic Diseases Circulation, November 22, 2005; 112(21): 3337 - 3347. [Full Text] [PDF] |
||||
![]() |
G Liuzzo, G Giubilato, and M Pinnelli T cells and cytokines in atherogenesis Lupus, September 1, 2005; 14(9): 732 - 735. [Abstract] [PDF] |
||||
![]() |
G. Caligiuri, E. Groyer, J. Khallou-Laschet, A. A. H. Zen, J. Sainz, D. Urbain, A.-T. Gaston, M. Lemitre, A. Nicoletti, and A. Lafont Reduced Immunoregulatory CD31+ T Cells in the Blood of Atherosclerotic Mice With Plaque Thrombosis Arterioscler Thromb Vasc Biol, August 1, 2005; 25(8): 1659 - 1664. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Methe, S. Brunner, D. Wiegand, M. Nabauer, J. Koglin, and E. R. Edelman Enhanced T-Helper-1 Lymphocyte Activation Patterns in Acute Coronary Syndromes J. Am. Coll. Cardiol., June 21, 2005; 45(12): 1939 - 1945. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. K. Hansson Inflammation, Atherosclerosis, and Coronary Artery Disease N. Engl. J. Med., April 21, 2005; 352(16): 1685 - 1695. [Full Text] [PDF] |
||||
![]() |
M. R. Snyder, T. Nakajima, P. J. Leibson, C. M. Weyand, and J. J. Goronzy Stimulatory Killer Ig-Like Receptors Modulate T Cell Activation through DAP12-Dependent and DAP12-Independent Mechanisms J. Immunol., September 15, 2004; 173(6): 3725 - 3731. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. M. M. van Leeuwen, E. B. M. Remmerswaal, M. T. M. Vossen, A. T. Rowshani, P. M. E. Wertheim-van Dillen, R. A. W. van Lier, and I. J. M. ten Berge Emergence of a CD4+CD28- Granzyme B+, Cytomegalovirus-Specific T Cell Subset after Recovery of Primary Cytomegalovirus Infection J. Immunol., August 1, 2004; 173(3): 1834 - 1841. [Abstract] [Full Text] [PDF] |
||||
![]() |
C Turesson, A Jarenros, and L Jacobsson Increased incidence of cardiovascular disease in patients with rheumatoid arthritis: results from a community based study Ann Rheum Dis, August 1, 2004; 63(8): 952 - 955. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Gerli, G. Schillaci, A. Giordano, E. B. Bocci, O. Bistoni, G. Vaudo, S. Marchesi, M. Pirro, F. Ragni, Y. Shoenfeld, et al. CD4+CD28- T Lymphocytes Contribute to Early Atherosclerotic Damage in Rheumatoid Arthritis Patients Circulation, June 8, 2004; 109(22): 2744 - 2748. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Zal, J. C. Kaski, G. Arno, J. P. Akiyu, Q. Xu, D. Cole, M. Whelan, N. Russell, J. A. Madrigal, I. A. Dodi, et al. Heat-Shock Protein 60-Reactive CD4+CD28null T Cells in Patients With Acute Coronary Syndromes Circulation, March 16, 2004; 109(10): 1230 - 1235. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Herrmann, A. Ciechanover, L. O Lerman, and A. Lerman The ubiquitin-proteasome system in cardiovascular diseases--a hypothesis extended Cardiovasc Res, January 1, 2004; 61(1): 11 - 21. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Sattar, D. W. McCarey, H. Capell, and I. B. McInnes Explaining How "High-Grade" Systemic Inflammation Accelerates Vascular Risk in Rheumatoid Arthritis Circulation, December 16, 2003; 108(24): 2957 - 2963. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Mallat, A. Gojova, V. Brun, B. Esposito, N. Fournier, F. Cottrez, A. Tedgui, and H. Groux Induction of a Regulatory T Cell Type 1 Response Reduces the Development of Atherosclerosis in Apolipoprotein E-Knockout Mice Circulation, September 9, 2003; 108(10): 1232 - 1237. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. N. Vallejo, H. Yang, P. A. Klimiuk, C. M. Weyand, and J. J. Goronzy Synoviocyte-Mediated Expansion of Inflammatory T Cells in Rheumatoid Synovitis Is Dependent on CD47-Thrombospondin 1 Interaction J. Immunol., August 15, 2003; 171(4): 1732 - 1740. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Nakajima, O. Goek, X. Zhang, S. L. Kopecky, R. L. Frye, J. J. Goronzy, and C. M. Weyand De Novo Expression of Killer Immunoglobulin-Like Receptors and Signaling Proteins Regulates the Cytotoxic Function of CD4 T Cells in Acute Coronary Syndromes Circ. Res., July 25, 2003; 93(2): 106 - 113. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Soejima, A. Irie, S. Miyamoto, I. Kajiwara, S. Kojima, J. Hokamaki, T. Sakamoto, T. Tanaka, M. Yoshimura, Y. Nishimura, et al. Preference Toward a T-Helper Type 1 Response in Patients With Coronary Spastic Angina Circulation, May 6, 2003; 107(17): 2196 - 2200. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Snyder, M. Lucas, E. Vivier, C. M. Weyand, and J. J. Goronzy Selective Activation of the c-Jun NH2-terminal Protein Kinase Signaling Pathway by Stimulatory KIR in the Absence of KARAP/DAP12 in CD4+ T Cells J. Exp. Med., February 17, 2003; 197(4): 437 - 449. [Abstract] [Full Text] [PDF] |
||||
![]() |
A D Filer, J M Gardner-Medwin, J Thambyrajah, K Raza, D M Carruthers, R J Stevens, L Liu, S E Lowe, J N Townend, and P A Bacon Diffuse endothelial dysfunction is common to ANCA associated systemic vasculitis and polyarteritis nodosa Ann Rheum Dis, February 1, 2003; 62(2): 162 - 167. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. G. Spagnoli, E. Bonanno, A. Mauriello, G. Palmieri, A. Partenzi, G. Sangiorgi, and F. Crea Multicentric inflammation in epicardial coronary arteries of patients dying of acute myocardial infarction J. Am. Coll. Cardiol., November 6, 2002; 40(9): 1579 - 1588. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Snyder, L.-O. Muegge, C. Offord, W. M. O'Fallon, Z. Bajzer, C. M. Weyand, and J. J. Goronzy Formation of the Killer Ig-Like Receptor Repertoire on CD4+CD28null T Cells J. Immunol., April 15, 2002; 168(8): 3839 - 3846. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Maseri and D. Cianflone Inflammation in acute coronary syndromes Eur. Heart J. Suppl., March 1, 2002; 4(suppl_B): B8 - B13. [Abstract] [PDF] |
||||
![]() |
T. Nakajima, S. Schulte, K. J. Warrington, S. L. Kopecky, R. L. Frye, J. J. Goronzy, and C. M. Weyand T-Cell-Mediated Lysis of Endothelial Cells in Acute Coronary Syndromes Circulation, February 5, 2002; 105(5): 570 - 575. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Mazzone, C. Cusa, I. Mazzucchelli, M. Vezzoli, E. Ottini, R. Pacifici, P. Zuccaro, and C. Falcone Increased production of inflammatory cytokines in patients with silent myocardial ischemia J. Am. Coll. Cardiol., December 1, 2001; 38(7): 1895 - 1901. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.C. Kaski and E.G. Zouridakis Inflammation, infection and acute coronary plaque events Eur. Heart J. Suppl., August 1, 2001; 3(suppl_I): I10 - I15. [Abstract] [PDF] |
||||
![]() |
J.-H. Yen, B. E. Moore, T. Nakajima, D. Scholl, D. J. Schaid, C. M. Weyand, and J. J. Goronzy Major Histocompatibility Complex Class I-Recognizing Receptors Are Disease Risk Genes in Rheumatoid Arthritis J. Exp. Med., May 21, 2001; 193(10): 1159 - 1168. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2000 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |