(Circulation. 2000;101:1867.)
© 2000 American Heart Association, Inc.
Basic Science Reports |
From the Department of Surgery (S.S., R.A.H.) and Departments of Pediatrics and Immunology (C.P.P., J.L.P.), Mayo Clinic, Rochester, Minn.
Correspondence to Soheyla Saadi, PhD, Mayo Clinic, Medical Science 266, Rochester, MN 55905. E-mail saadi.soheyla{at}mayo.edu
| Abstract |
|---|
|
|
|---|
. We asked whether the MAC activates porcine
aortic and microvascular ECs in a global manner by this mechanism and
whether this mechanism is used by membrane pore-forming
structures.
Methods and ResultsExposure of ECs to complement caused
upregulation of mRNAs for E-selectin, intracellular adhesion
molecule-1, vascular cell adhesion molecule-1, I
-B
, interleukin
(IL)-1
, IL-1ß, IL-8, and plasminogen
activator inhibitor-1 over a period of 6 hours.
The expression of these genes was not a primary response to
stimulation, however, because IL-1 receptor antagonist
inhibited expression of these genes. Activation of ECs by complement
depended on the autocrine action of IL-1
, because
complement-mediated EC activation was inhibited by antiIL-1
antibodies. Melittin and mastoparan, amphiphilic pore-forming peptides
like the MAC, induced E-selectin through intermediary action of
IL-1.
ConclusionsThese findings suggest that transmembrane
pore-forming proteins, as a class of molecules, activate ECs
through the autocrine effects of IL-1
.
Key Words: pore-forming peptides endothelium interleukin-1
| Introduction |
|---|
|
|
|---|
B
leading to upregulation of tissue factor, E-selectin, and IL-1
mRNAs.8 Interaction of complement anaphylatoxins, such as C5a, and terminal complement complexes with ECs triggers changes in ECs similar to those induced by cytokines. Anaphylatoxins and the membrane attack complex (MAC) may induce changes that occur within minutes and include formation of intercellular gaps,9 expression of P-selectin,10 and activation of proteinases that cleave and release heparan sulfate proteoglycan from EC surfaces.11 The MAC also induces changes that occur over a period of hours, which include upregulation of tissue factor, cyclooxygenase-2, and chemokines.12 13 14
Although the assembly of MAC in ECs causes procoagulant and
inflammatory changes, like those induced by cytokines, the
upregulation of tissue factor and cyclooxygenase-2
in ECs occurs much more slowly than corresponding changes induced by
cytokines. For example, whereas tumor necrosis factor (TNF)-
leads to immediate upregulation of tissue factor,4 MAC
upregulates tissue factor14 and Cox-213 over
6 to 8 hours, suggesting that the upregulation of these genes might not
be a primary response in ECs. Indeed, MAC induces the IL-1
gene as a primary response that acts on ECs to promote expression of
tissue factor and Cox-2.13 14
Whether this distinct pathway of EC activation is unique to MAC or reflects a response to the broader class of transmembrane pore-forming proteins is unknown. Here, we show that EC activation by MAC is a prototype for EC activation by transmembrane pore-forming peptides.
| Methods |
|---|
|
|
|---|
and TNF-
were from Genzyme.
[
-32P]dCTP was from DuPont-NEN. IL-1
receptor antagonist (IL-1ra) and antihuman
IL-1
neutralizing antibodies were from R&D Systems. Melittin and
mastoparan were from Calbiochem. sCR1 was from T-Cell
Sciences.
EC Cultures
Porcine aortic ECs were isolated, characterized, and cultured as
described previously.9 Porcine aortic ECs expressing human
DAF and CD59 were isolated from transgenic pigs obtained from Nextran
Inc.15 Porcine cardiac microvascular ECs were isolated as
described.16 EC monolayers (passages 3 to 6) were grown to
confluence on gelatin-coated plates and were maintained in fresh DMEM
with 10% FCS for 48 to 72 hours before each experiment. The purity of
EC cultures was determined on the basis of uptake of acetylated
LDL and the lack of staining for
-actin.
Anti-EC Antibodies and Complement
Samples of human, porcine, and rabbit blood were used as sources
of anti-EC antibodies and complement as previously
described.14 17 Complement activation was determined as
described.9 When endotoxin contamination was of concern,
the limulus amoebocyte lysate test18 was performed.
Generally, serum, purified serum components, and various components
used for stimulation of ECs did not show detectable amounts of
endotoxin.
Expression of E-Selectin and Tissue Factor on ECs
Expression of E-selectin on monolayers of porcine aortic and
microvascular ECs was measured by ELISA using monoclonal antihuman
E-selectin antibodies as described.19 Expression of tissue
factor on ECs was measured by assays for tissue factor activity as
described.14
Analysis of mRNA by Polymerase Chain Reaction
Total RNA from ECs was analyzed as
described.14 Sequences of primers used for polymerase
chain reaction (PCR) are as follows: ß-actin, ATGTTTGAGACCTTCAACAC,
CACGTCACACTTCATGATGGA; E-selectin, AGCAAGCCAGAGCAACACAG,
TTGCCCGAGTCCTTGTCTCT; VCAM-1, GAACGAACACTCTTACCT, TTCCATCCTCATAGCAAT;
ICAM-1, GGGAGGAGGAGCTGTTCA, AGGTGGGAAGCTGTAGAA; IL-1ß,
GAGGCTGATGGCCCCAAAGAG, CCTCCAGCTGCAGGGTGGGCG; IL-6,
CATTAAGTACATCCTCGGCAA, TAGTGTCCTAACGCTCA; PAI-1, GTGTTTCAGCAGGTGG,
TGAGCCATCATGGGCAC; vWF, CGCCGCTGCACGACTTCT, GCTCCAGCTCGTCCACAC;
I
B
, AGCGGCTACTGGATGAC, GCCTCCAAGCACGCAGTC; and
IL-1
, GCAGCCACCGGGAAGATTCTG, GTACATACGGCCTGTCAACAC. The annealing
temperature was 55°C for all reactions except IL-1ß and vWF, for
which the temperature was 63°C. All reactions were 30 cycles except
for ß-actin, which was 25 cycles. The identity of all PCR
products was confirmed by sequencing (not shown).
Generation of AntiPorcine IL-1
Antibodies
Porcine IL-1
cDNA (M86730) encoding mature IL-1
was cloned
in plasmid PHIL-S1 (Invitrogen). The resulting recombinant plasmid that
carries 195 amino acids of putative mature IL-1
was used to
transform the yeast Pichia and the recombinant IL-1
were
overexpressed as suggested by the manufacturer. Recombinant
porcine IL-1
was used to immunize rabbits. The rabbit polyclonal
anti-IL-1
antibodies inhibited the activity of IL-1
.
Immunoprecipitation of IL-1
ECs in 24-well plates were pulse-labeled with 100 µCi/mL of
35S-methionine (specific activity >1000 Ci/mmol)
for 2 hours. The immunoprecipitation was performed as
described.20 For each reaction, 50 µg rabbit
antiporcine IL-1
antibodies was used. Samples were resolved on
18% polyacrylamide gels, dried, and exposed to Kodak X-Omat AR
film for 21 days.
| Results |
|---|
|
|
|---|
-B
,
IL-1
, IL-8, and PAI-1 (Figure 1
|
Role of Complement in EC Activation
We showed that complement activation was actually required for
activation of ECs by the following experiments. First, upregulation of
genes for E-selectin, IL-1
, and tissue factor did not occur when
soluble CR1 (sCR1) was added to the human serum applied to porcine
aortic ECs (Figure 2A
). Second, porcine
aortic ECs transgenic for human decay-accelerating factor (DAF) and
CD59,21 which inhibit complement at the levels of
C3 and C8/C9, respectively, did not show evidence of activation after
stimulation with 15% human complement (Figure 2B
), although the
transgenic cells were readily activated by IL-1
(Figure 2B
).
|
Effect of Complement on Microvascular ECs
Because much of the tissue damage brought about by activation of
complement occurs in small blood vessels, we asked whether complement
activates microvascular ECs as it does aortic ECs. Stimulation
of porcine cardiac microvascular ECs by human anti-EC antibodies and
complement caused expression of E-selectin and tissue factor over a
period of 16 hours (Figure 3
). sCR1 also
prevented activation of cardiac microvascular ECs by human serum,
indicating that complement activates microvascular ECs as it
does aortic ECs.
|
Kinetics of EC Activation
We next questioned whether the kinetics of EC activation in
response to complement differs from the kinetics of the response to
cytokines. In 5 experiments, stimulation of porcine aortic and
microvascular ECs by IL-1
or TNF-
led to expression of E-selectin
protein within 2 hours (Figure 4
).
Conversely, stimulation of aortic ECs with complement led to expression
of E-selectin only at
8 hours (Figure 4A
) and stimulation of
microvascular ECs by complement led to expression of E-selectin only at
6 hours after stimulation (Figure 4B
). The more rapid
expression of E-selectin on microvascular ECs was seen in repeated
experiments. The delay in expression of E-selectin by ECs after
exposure to complement was not limited by the rate of complement
activation, because iC3b was deposited on ECs as early as 30 minutes
after exposure to human serum (Figure 5
).
Figure 5A
also shows that whereas complement activation peaked
at 1 to 2 hours, induction of E-selectin mRNA by complement did not
occur until 8 hours had elapsed.
|
|
Activation of ECs in Response to Complement Is
IL-1
Mediated
We tested whether upregulation of E-selectin by complement was
mediated by IL-1
, as reported for tissue factor and
cyclooxygenase-2.13 14 Four lines of
evidence supported this mechanism. First, as shown in Figure 1A
, mRNA for IL-1
appeared as early as 1 hour before expression of genes
for E-selectin. Second, human recombinant IL-1 receptor
antagonist (IL-1ra), which is cross-reactive among
species,22 23 blocked complement-mediated upregulation of
genes for E-selectin, ICAM-1, VCAM-1, I
-B
, IL-1ß, IL-6, and
PAI-1 in porcine aortic ECs (Figure 6A
).
The human recombinant IL-1ra also prevented complement-induced
expression of E-selectin protein and tissue factor activity in cardiac
microvascular ECs (Figure 6
, B and C). Third, the response to
complement was mediated by IL-1
rather than by IL-1ß, because
IL-1ß mRNA was detected only 16 hours after stimulation with
complement. Fourth, IL-1
was the active component in conditioned
medium obtained from ECs treated with complement, because the ability
of conditioned medium to activate quiescent ECs was inhibited
by addition of antiporcine IL-1
antibodies (Figure 7C
). The inhibition of
complement-mediated EC activation by the IL-1ra was not caused by a
generalized suppression of EC responses, because IL-1ra did not inhibit
EC activation by endotoxin (not shown).
|
|
The synthesis of IL-1
protein in ECs stimulated by complement was
examined by immunoprecipitation using polyclonal antiIL-1
antibodies generated against recombinant porcine IL-1
. In 6
experiments, cell-associated IL-1
polypeptide was detected as early
as 3 hours after stimulation of porcine ECs with human complement.
EC-associated IL-1
was detected as a precursor and processed
products of 30 to 35 kDa in cells. The antipig IL-1
antibodies, like other antiIL-1 antibodies,20
immunoprecipitated IL-1
from cell lysates. Although IL-1
could be
detected in the supernatant by functional assay based on specific
inhibition (Figure 7C
), the processed protein was not detected.
Although the extent of processing varied between
experiments,24 cell-associated IL-1
was absent in
resting ECs and complement-treated porcine ECs transgenic for human DAF
and CD59 (Figure 7B
).
We next questioned whether ECs store IL-1
, which would be released
by complement, resulting in EC activation. The following suggested the
absence of IL-1
in quiescent ECs. First, immunoprecipitation
experiments (Figure 7B
) revealed the lack of IL-1
in resting
ECs. Second, conditioned medium obtained from ECs exposed to complement
for 30 minutes lacked IL-1
activity (Figure 7C
, inset).
Third, expression of IL-1
mRNA at 1 hour required active RNA
synthesis in ECs, because actinomycin D inhibited its expression in
this system (Figure 7A
).
Role of Pore-Forming Proteins in Activation of ECs by
Complement
The MAC was necessary for the activation of ECs, because a
complement source lacking C8 did not induce E-selectin, whereas this
C8-depleted serum reconstituted with purified C8 did so (Figure 8
). To test whether in activating ECs,
the MAC was representative of membrane pore-forming
proteins, we asked whether melittin, an amphipathic pore-forming
peptide from bee venom similar to C9,25 activates
ECs like MAC. Treatment of aortic ECs with melittin caused upregulation
of IL-1
mRNA at a rate similar to that observed with complement and
induced expression of E-selectin at 8 hours, with a peak expression at
12 hours (Figure 9
). Induction of
E-selectin in ECs by melittin, as with complement, was dependent on
IL-1, because IL-1ra inhibited E-selectin expression by ECs exposed to
melittin (Figure 9
, B and C). Melittin also activated
microvascular ECs via the IL-1
pathway, because the induction of
E-selectin was inhibited by IL-1ra (Figure 10
). Mastoparan, another pore-forming
peptide, also induced E-selectin in an IL-1dependent manner (not
shown). These findings suggest that transmembrane pore-forming
structures activate ECs through the autocrine effects of
IL-1
and that a common mechanism governs activation of aortic and
microvascular ECs by the MAC and the MAC-like transmembrane
pore-forming structures.
|
|
|
| Discussion |
|---|
|
|
|---|
and autocrine action of IL-1
on
endothelium, leading to localized inflammation and
coagulation.
The difference between the mechanism of EC activation by
pore-forming structures and the mechanism of EC activation by
cytokines may stem from the way these mediators interact with
ECs. IL-1 and TNF-
bind to their corresponding receptors, which
transduce signals, leading to activation of NF-
B and subsequent
induction of genes possessing NF-
B binding sites. Pore-forming
proteins, conversely, do not interact with specific receptors but
rather randomly insert in cell membranes. Insertion of the MAC in EC
membranes may activate the extracellular signal-regulated
kinase (ERK) pathway, as it does in B cells,29 leading to
the induction of IL-1
.
One prominent effect of the MAC on many cell types is an increase in
cytoplasmic Ca2+. Alterations in intracellular
concentration of Ca2+ may in turn play a role in
the induction of IL-1
by the MAC and other pore-forming peptides.
Increased concentration of intracellular Ca2+ is
also thought to be important in surface expression of P-selectin from
ECs exposed to the MAC.30 Consistent with the
importance of Ca2+ in this system, we have found
that a decrease in extracellular concentration of
Ca2+ inhibits EC expression of E-selectin in
response to complement (not shown).
Porcine aortic or microvascular ECs appear to respond differently than
human umbilical vein ECs (HUVECs) to pore-forming peptides. Our
preliminary experiments have shown that pore-forming peptides also
activate human aortic ECs. HUVECs were recently found to
respond rapidly to cytolytically inactive terminal complement
complexes, upregulating E-selectin at a rate resembling the response to
endotoxin.31 How the cytolytically inactive terminal
complement complexes activated the HUVECs is not known,
however, and it is possible that EC activation in this system is also
IL-1
dependent. The apparent difference between responses of HUVECs
and aortic ECs to terminal complement complexes may also stem from
different biological properties of these cells. For example, HUVECs,
being fetal cells, express platelet-derived growth factors that
maintain a partially activated state.32
Clearly, the activation of ECs by MAC can account for widespread
inflammatory reactions seen in complement-mediated disorders. Our
results suggest that activation of ECs in this way is likely to be the
result of the synthesis and release of pluripotent IL-1
. IL-1
might impair regional blood flow by causing expression of
vasoconstrictors such as thromboxane A2 and endothelin-1,
which not only localize the injury but also amplify the effect by
increasing the local concentration of IL-1
, causing expression of
tissue factor, PAI-1, chemokines, and adhesion molecules. This
impairment in regional blood flow could also result in a decrease in
local pH, which in turn would optimize the activity of heparanase that
is inactive at physiological pH but is active under
acidic conditions.33 Activation of heparanase, in turn,
might cause degradation and removal of heparan sulfate proteoglycans
from ECs, with consequent loss of anticoagulant, anti-inflammatory, and
barrier function, adding to the changes associated with activation of
ECs.
| Acknowledgments |
|---|
Received July 21, 1999; revision received November 19, 1999; accepted December 2, 1999.
| References |
|---|
|
|
|---|
2. Broze GS Jr. Tissue factor pathway inhibitor. Thromb Haemost. 1995;74:9093.[Medline] [Order article via Infotrieve]
3.
Luscher TF, Boulanger CM, Dohi Y, Yang Z.
Endothelium-derived contracting factors.
Hypertension. 1992;19:117130.
4.
Bevilacqua MP, Pober JS, Majeau GR, Cotran RS,
Gimbrone MA Jr. Interleukin 1 (IL-1) induces biosynthesis and cell
surface expression of procoagulant activity in human vascular EC.
J Exp Med. 1984;160:618623.
5. Bevilacqua MP, Schleef RR, Gimbrone MA Jr, Loskutoff DJ. Regulation of the fibrinolytic system of cultured human vascular endothelium by interleukin 1. J Clin Invest. 1986;78:587591.
6.
Bevilacqua MP, Pober JS, Mendrick DL, Cotran RS,
Gimbrone MA Jr. Identification of an inducible
endothelial-leukocyte adhesion molecule. Proc
Natl Acad Sci U S A. 1987;84:92389242.
7. Warner SJC, Auger KP, Libby P. Interleukin 1 induces interleukin 1, II: recombinant human interleukin 1 induces interleukin 1 production by adult human vascular EC. J Immunol. 1987;139:19111917.[Abstract]
8.
Collins T, Read MA, Neish AS, Whitley MZ, Thanos D,
Maniatis T. Transcriptional regulation of endothelial
cell adhesion molecules: NF-
B and cytokine-inducible
enhancers. FASEB J. 1995;9:899909.[Abstract]
9.
Saadi S, Platt JL. Transient perturbation of
endothelial integrity induced by antibodies and
complement. J Exp Med. 1995;181:2131.
10. Foreman KE, Vaporciyan AA, Bonish BK, Jones ML, Johnson KJ, Glovsky MM, Eddy SM, Ward PA. C5a-induced expression of P-selectin in endothelial cells. J Clin Invest. 1994;94:11471155.
11. Ihrcke NS, Platt JL. Shedding of heparan sulfate proteoglycan by stimulated EC: evidence for proteolysis of cell surface molecules. J Cell Physiol. 1996;168:625637.[Medline] [Order article via Infotrieve]
12.
Selvan RS, Kapadia HB, Platt JL. Complement-induced
expression of chemokine genes in endothelium:
regulation by IL-1-dependent and -independent mechanisms. J
Immunol. 1998;161:43884395.
13. Bustos M, Coffman TM, Saadi S, Platt JL. Modulation of eicosanoid metabolism in EC in a xenograft model: role of cyclooxygenase-2. J Clin Invest. 1997;100:11501158.[Medline] [Order article via Infotrieve]
14.
Saadi S, Holzknecht RA, Patte CP, Stern DM, Platt JL.
Complement-mediated regulation of tissue factor activity in
endothelium. J Exp Med. 1995;182:18071814.
15. Byrne GW, McCurry KR, Martin MJ, McClellan SM, Platt JL, Logan JS. Transgenic pigs expressing human CD59 and decay-accelerating factor produce an intrinsic barrier to complement-mediated damage. Transplantation. 1997;63:149155.[Medline] [Order article via Infotrieve]
16.
Nishida M, Carley WW, Gerritsen ME, Ellingsen O, Kelly
RA, Smith TW. Isolation and characterization of human and rat cardiac
microvascular EC. Am J Physiol. 1993;264:H639H652.
17. Platt JL, Turman MA, Noreen HJ, Fischel RJ, Bolman RM, Bach FH. An ELISA assay for xenoreactive natural antibodies. Transplantation. 1990;49:10001001.[Medline] [Order article via Infotrieve]
18. Levin J, Bang FB. Clottable protein in Limulus: its localization and kinetics of its coagulation by endotoxin. Thromb Diath Haemorrh. 1968;19:186197.[Medline] [Order article via Infotrieve]
19. Malyguine AM, Saadi S, Holzknecht RA, Patte CR, Sud N, Platt JL, Dawson JR. Induction of procoagulant function in porcine EC by human NK cells. J Immunol. 1997;159:46594664.[Abstract]
20. Hogquist KA, Unanue ER, Chaplin DD. Release of IL-1 from mononuclear phagocytes. J Immunol. 1991;147:21812186.[Abstract]
21. Byrne G, McCurry K, Martin M, McClellan SM, Platt JL, Logan J. Development and analysis of transgenic pigs expressing the human complement regulatory protein CD59 and DAF.. Transplant Proc.. 1996;28:759.[Medline] [Order article via Infotrieve]
22. Shiraishi M, Csete M, Yasunaga C, McDiarmid SV, Vannice JL, Busuttil RW, Shaked A. The inhibitor cytokine interleukin-1 receptor antagonist synergistically augments cyclosporine immunosuppression in a rat cardiac allograft model. J Surg Res. 1995;58:465470.[Medline] [Order article via Infotrieve]
23. Russell DA, Tucker KK, Chinookoswong N, Thompson RC, Kohno T. Combined inhibition of interleukin-1 and tumor necrosis factor in rodent endotoxemia: improved survival and organ function. J Infect Dis. 1995;171:15281538.[Medline] [Order article via Infotrieve]
24. Carinci V, Guida S, Fontana MR, Palla E, Rossini M, Melli M. Processing of interleukin-1 in cells of monocytic lineage is differentiation-dependent. Eur J Biochem. 1992;203:293301.
25. Laine RO, Morgan BP, Esser AF. Comparison between complement and melittin hemolysis: anti-melittin antibodies inhibit complement lysis. Biochemistry. 1988;27:53085314.[Medline] [Order article via Infotrieve]
26. McCurry KR, Kooyman DL, Diamond LE, Byrne GW, Logan JS, Platt JL. Human complement regulatory proteins in transgenic animals regulate complement activation in xenoperfused organs. Transplant Proc. 1995;27:317318.[Medline] [Order article via Infotrieve]
27. Mackler BF, Kreil G. Honey bee venom melittin. Inflammation. 1977;2:5565.[Medline] [Order article via Infotrieve]
28. Ferreira DB, Costa RS, Mello DOJA, Muccillo G. An infarct-like myocardial lesion experimentally induced in Wistar rats with Africanized bee venom. J Pathol. 1995;177:95102.[Medline] [Order article via Infotrieve]
29. Niculescu F, Rus H, van Biesen T, Shin ML. Activation of Ras and mitogen-activated protein kinase pathway by terminal complement complexes is G protein dependent. J Immunol. 1997;158:44054412.[Abstract]
30.
Hattori R, Hamilton KK, McEver RP, Sims PJ.
Complement proteins C5b-9 induce secretion of high molecular weight
multimers of endothelial von Willebrand
factor and translocation of granule membrane protein GMP-140 to the
cell surface. J Biol Chem. 1989;264:90539060.
31.
Tedesco F, Pausa M, Nardon E, Introna M, Mantovani A,
Dobrina A. Cytolytically inactive terminal complement complex
activates EC to express adhesion molecules and tissue factor
procoagulant activity. J Exp Med. 1997;185:16191627.
32. Morris TE, Mattox PA, Shipley GD, Wagner CR, Hosenpud JD. The pattern of cytokine messenger RNA expression in human aortic EC is different from that of human umbilical vein EC. Transplant Immunol. 1993;1:137142.[Medline] [Order article via Infotrieve]
33.
Ihrcke NS, Parker W, Reissner KJ, Platt JL. Regulation
of platelet heparanase during inflammation: role of pH and
proteinases. J Cell Physiol. 1998;175:255267.The
mechanism by which pore-forming structures disturb the functions of
endothelium was investigated. Amphiphilic pore-forming
peptides, such as the membrane attack complex, melittin, and
mastoparan, activated aortic and microvascular
endothelial cells, not directly but through the
autocrine action of IL-1
. Thus, pore-forming structures as a class
act differently from other agonists on endothelial
cells.[Medline]
[Order article via Infotrieve]
This article has been cited by other articles:
![]() |
L. R. La Bonte, B. Dokken, G. Davis-Gorman, G. L. Stahl, and P. F. McDonagh The mannose-binding lectin pathway is a significant contributor to reperfusion injury in the type 2 diabetic heart Diabetes and Vascular Disease Research, July 1, 2009; 6(3): 172 - 180. [Abstract] [PDF] |
||||
![]() |
G Girardi and N Mackman Tissue factor in antiphospholipid antibody-induced pregnancy loss: a pro-inflammatory molecule Lupus, October 1, 2008; 17(10): 931 - 936. [Abstract] [PDF] |
||||
![]() |
G. J. Brunn, S. Saadi, and J. L. Platt Constitutive Repression of Interleukin-1{alpha} in Endothelial Cells Circ. Res., April 11, 2008; 102(7): 823 - 830. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. R. La Bonte, G. Davis-Gorman, G. L. Stahl, and P. F. McDonagh Complement inhibition reduces injury in the type 2 diabetic heart following ischemia and reperfusion Am J Physiol Heart Circ Physiol, March 1, 2008; 294(3): H1282 - H1290. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Rao, K. J. Tracey, and J. S. Pober IL-1{alpha} and IL-1beta Are Endogenous Mediators Linking Cell Injury to the Adaptive Alloimmune Response J. Immunol., November 15, 2007; 179(10): 6536 - 6546. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Redecha, R. Tilley, M. Tencati, J. E. Salmon, D. Kirchhofer, N. Mackman, and G. Girardi Tissue factor: a link between C5a and neutrophil activation in antiphospholipid antibody induced fetal injury Blood, October 1, 2007; 110(7): 2423 - 2431. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Simeoni, J. Dudler, S. Fleury, J. Li, M. Pagnotta, M. Pascual, L. K. von Segesser, and G. Vassalli Gene transfer of a soluble IL-1 type 2 receptor-Ig fusion protein improves cardiac allograft survival in rats Eur. J. Cardiothorac. Surg., February 1, 2007; 31(2): 222 - 228. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Tinckam and A. Chandraker Mechanisms and Role of HLA and non-HLA Alloantibodies Clin. J. Am. Soc. Nephrol., May 1, 2006; 1(3): 404 - 414. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. J. Brunn, S. Saadi, and J. L. Platt Differential Regulation of Endothelial Cell Activation by Complement and Interleukin 1{alpha} Circ. Res., March 31, 2006; 98(6): 793 - 800. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Koch, A. Kanazawa, R. Nishitai, B. E. Knudsen, K. Ogata, T. B. Plummer, K. Butters, and J. L. Platt Intrinsic Resistance of Hepatocytes to Complement-Mediated Injury J. Immunol., June 1, 2005; 174(11): 7302 - 7309. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Turnberg, M. Botto, M. Lewis, W. Zhou, S. H. Sacks, B. P. Morgan, M. J. Walport, and H. T. Cook CD59a Deficiency Exacerbates Ischemia-Reperfusion Injury in Mice Am. J. Pathol., September 1, 2004; 165(3): 825 - 832. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Koch, Z. I. Khalpey, and J. L. Platt Accommodation: Preventing Injury in Transplantation and Disease J. Immunol., May 1, 2004; 172(9): 5143 - 5148. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Saadi, T. Takahashi, R. A. Holzknecht, and J. L. Platt Pathways to Acute Humoral Rejection Am. J. Pathol., March 1, 2004; 164(3): 1073 - 1080. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Turnberg, M. Botto, J. Warren, B. P. Morgan, Mark. J. Walport, and H. T. Cook CD59a Deficiency Exacerbates Accelerated Nephrotoxic Nephritis in Mice J. Am. Soc. Nephrol., September 1, 2003; 14(9): 2271 - 2279. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. SAADI, L. E. WRENSHALL, and J. L. PLATT Regional manifestations and control of the immune system FASEB J, June 1, 2002; 16(8): 849 - 856. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Jordan, M. C. Montalto, and G. L. Stahl Inhibition of Mannose-Binding Lectin Reduces Postischemic Myocardial Reperfusion Injury Circulation, September 18, 2001; 104(12): 1413 - 1418. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2000 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |