Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation
Search: search_blue_button Advanced Search
Circulation. 2000;101:1812-1818

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schönberger, J.
Right arrow Articles by Seidman, C. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schönberger, J.
Right arrow Articles by Seidman, C. E.
Related Collections
Right arrow Congestive
Right arrow Heart failure - basic studies
Right arrow Myocardial cardiomyopathy disease
Right arrow Genetics of cardiovascular disease

(Circulation. 2000;101:1812.)
© 2000 American Heart Association, Inc.


Clinical Investigation and Reports

Dilated Cardiomyopathy and Sensorineural Hearing Loss

A Heritable Syndrome That Maps to 6q23–24

Jost Schönberger, MD; Hara Levy, MD; Ekkehard Grünig, MD; Somkiat Sangwatanaroj, MD; Diane Fatkin, MD; Calum MacRae, MBChB; Hinrich Stäcker, MD, PhD; Christopher Halpin, PhD; Roland Eavey, MD; Edward F. Philbin, MD; Hugo Katus, MD; J. G. Seidman, PhD; Christine E. Seidman, MD

From the Department of Genetics and Howard Hughes Medical Institute, Harvard Medical School (J.S., H.L., S.S., D.F., C.M., J.G.S., C.E.S.), the Department of Pulmonary Medicine, Children’s Hospital (H.L.), the Massachusetts Eye and Ear Infirmary (H.S., C.H., R.E.), and the Cardiovascular Division and Howard Hughes Medical Institute, Brigham and Women’s Hospital, (C.E.S.), Boston, Mass; the University of Heidelberg, Department of Medicine III, Heidelberg, Germany (E.G.); the Section of Heart Failure and Cardiac Transplantation, Henry Ford Hospital, Detroit, Mich (E.F.P.); and the University of Lübeck, Department of Medicine II, Lübeck, Germany (H.K.).

Correspondence to Christine E. Seidman, MD, Dept of Genetics/Alpert Room 533, Harvard Medical School, 200 Longwood Avenue, Boston MA 02115. E-mail cseidman{at}rascal.med.harvard.edu


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Background—Dilated cardiomyopathy (DCM) and sensorineural hearing loss (SNHL) are prevalent disorders that occur alone or as components of complex multisystem syndromes. Multiple genetic loci have been identified that, when mutated, cause DCM or SNHL. However, the isolated coinheritance of these phenotypes has not been previously recognized.

Methods and Results—Clinical evaluations of 2 kindreds demonstrated autosomal-dominant transmission and age-related penetrance of both SNHL and DCM in the absence of other disorders. Moderate-to-severe hearing loss was evident by late adolescence, whereas ventricular dysfunction produced progressive congestive heart failure after the fourth decade. DNA samples from the larger kindred (29 individuals) were used to perform a genome-wide linkage study. Polymorphic loci on chromosome 6q23 to 24 were coinherited with the disease (maximum logarithm of odds score, 4.88 at locus D6S2411). The disease locus must lie within a 2.8 cM interval between loci D6S975 and D6S292, a location that overlaps an SNHL disease locus (DFNA10). However, DFNA10 does not cause cardiomyopathy. The epicardin gene, which encodes a transcription factor expressed in the myocardium and cochlea, was assessed as a candidate gene by nucleotide sequence analysis; no mutations were identified.

Conclusions—A syndrome of juvenile-onset SNHL and adult-onset DCM is caused by a mutation at 6q23 to 24 (locus designated CMD1J). Recognition of this cardioauditory disorder allows for the identification of young adults at risk for serious heart disease, thereby enabling early intervention. Definition of the molecular cause of this syndrome may provide new information about important cell physiology common to both the ear and heart.


Key Words: cardiomyopathy • hearing loss, sensorineural • genetics


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Inherited gene defects cause a significant fraction of both hearing loss and cardiomyopathy. Hearing loss is the most prevalent human sensory defect; in developed countries, a genetic cause accounts for {approx}60% of early-onset hearing loss. More than 40 different nonsyndromic deafness loci have been reported. Cochlear hair cell and/or neuronal malfunction of the inner ear cause sensorineural hearing loss (SNHL).1 2 3 4

Dilated cardiomyopathy (DCM), a disorder characterized by ventricular dilation and contractile dysfunction, is a leading cause of heart failure, with a prevalence of 36.5 per 100 000 individuals.5 Several studies indicate that 25% to 30% of DCM is familial,6 7 8 but the definition of the genomic location of the disease loci and the identification of disease genes has been hindered both by the significant mortality and the late age of onset of this disease. Nevertheless, 7 DCM loci (CMD1A-G) have been defined in this genetically heterogeneous disease.9 10 11 12 13 14 15 Although the disease genes at these loci have not been identified, 2 disease genes for DCM, actin and desmin, have been identified by candidate gene approaches.16 17

Many human syndromes exhibit heart and ear abnormalities in association with other organ disease.18 Alstrom syndrome, which was recently mapped to chromosome 2p12 to 13,19 causes DCM and hearing impairment in the setting of cone-rod ocular dystrophy, obesity, and non–insulin-dependent diabetes.20 Rosenberg syndrome causes X-linked cardiomyopathy and SNHL with hyperuricemia and ataxia.18 Mutations in mitochondria tRNAs perturb cardiac function and hearing,21 22 23 but they typically have associated encephalomyelopathy, skeletal myopathies, and/or metabolic abnormalities; these defects are further distinguished by matrilineal inheritance.

The finding of cardioauditory disease in the absence of other disease is rare. The classic example is Jervell and Lange-Nielsen syndrome, a disorder characterized by congenital deafness and cardiac arrhythmias (long-QT syndrome); notably, in this disease, cardiac structure is normal. Genetic studies of Jervell and Lange-Nielsen syndrome have demonstrated that recessive mutations in the KVLQT1 gene on chromosome 11p15.5 or the ISK gene on chromosome 21q22.1 to 22.224 25 cause this disorder.

We report a new heritable cardioauditory syndrome characterized by postlingual SNHL with DCM and demonstrate that the causal mutation maps to chromosome 6q23 to 24 (locus designation CMD1J). This unique phenotype provides advantages for the identification of candidate genes and establishes an early marker for identifying individuals at risk for significant cardiac disease.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Clinical Evaluations
Studies were performed in accordance with the Brigham and Women’s Hospital committee for the protection of human subjects from research risks. All family members were evaluated by clinical history, physical and otoscopic examination, 12-lead ECG, transthoracic 2D echocardiography, and audiological evaluations (air and bone audiograms performed at standard audiometric frequencies and recorded monosyllable lists at phonetically balanced maximum). Echocardiographic measurements of left ventricular wall thickness and cavity dimensions were determined from M-mode tracings. DCM was diagnosed on the basis of a left ventricular end-diastolic dimension >95% for normal individuals26 and/or fractional shortening <30%27 in the absence of known systemic or other cardiovascular disease.

Hearing was assessed by air and bone conduction and word recognition, as determined using 50-item Central Institute for the Deaf Wordlist 22 on compact disk.28 The level for word-recognition testing was set to a region of maximum performance as predicted by the Articulation Index, and it was never <55 dB of hearing loss.29 Hearing deficits were classified as absent, mild, moderate, moderate/severe, severe, or profound on the basis of the degree of hearing loss at <27, 27 to 40, 41 to 55, 56 to 70, 71 to 90, and >90 dB of hearing level, respectively.1 Disease status of deceased individuals was based on medical records.

Genetic Studies
Linkage studies were performed using DNA extracted from whole blood or Epstein Barr virus–transformed lymphocytes, as previously described.30 Linkage analyses used short tandem repeat markers spaced {approx}10 cM apart (Weber 8.0 Panel, Research Genetics). Polymerase chain reaction amplification was performed in a 10-µL reaction containing 20 ng of genomic DNA, fluorescence-labeled primers, and standard reagents for standard reaction times. Reaction products were pooled and mixed with size standards according to the manufacturer’s recommendations (Applied Biosystems Inc). Product sizes were determined on a 6% denaturing polyacrylamide gel using an ABI 377, with Genescan and Genotyper software (Perkin-Elmer). Alleles were determined without knowledge of clinical status.

Two-point logarithm of odds scores were calculated using MLINK (version 5.1), assuming a penetrance of 95% and a phenocopy rate of 0.001. Allele frequencies were determined from genotypes of unrelated individuals.

The order of loci used in haplotype constructions was based on the physical mapping data derived from the Whitehead Physical Mapping Project31 or determined using physical mapping of a yeast artificial chromosome contig. Candidate genes and expressed sequence tags were defined within the disease interval on the basis of yeast artificial chromosome content mapping.

Mutational Analysis of Epicardin
A 10-kilobase EcoRI fragment of PAC 524A10 (Roswell Park Cancer Institute) containing the epicardin gene was identified by hybridization with an epicardin cDNA probe (amplified using primers exon 1a-F and exon 2-R, below). This PAC maps to the human 6q23 to 24 region.32 A 10 kb fragment was subcloned into pBluescript. Positive clones selected by hybridization to this cDNA probe were expanded for DNA extraction (Qiagen) and sequenced using ABI 377 Big Dye sequence technology. Exon-intron boundaries were deduced from comparison with the cDNA sequence (Genbank accession number AF04741933 ). Primers corresponding to intron sequences external to splice signals were constructed and used to amplify and sequence exons encoding epicardin, as follows:

Exon 1a-F: CATTCGGGAGGCCTCTTGGTTTCA

Exon 1a-R: CCGCTCAGGGGGCTCTTCTTG

Exon 1b-F: CGGCGGCCTGGGCAAGAG

Exon 1b-R: GCGCCCTCACCCCCACTCC

Exon 2-F: CCTTTCATCTCAGGCCCCGAGTCC

Exon 2-R: GTTCTCGCGGGGTGGGACAG

Sequences of samples from affected and unaffected individuals were compared using ABI 377 and DNA-Star SeqMan software.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
The unusual disease phenotype in family MCE was recognized when 2 brothers (Individuals III-3 and III-5, Figure 1Down) with unexplained SNHL of >20 years duration developed progressive heart failure that necessitated cardiac transplantation. Coronary angiography in both excluded significant coronary artery disease. Family history and medical records revealed 4 deceased individuals with both hearing loss and heart disease; 3 died of heart failure (I-1, II-2, and II-3) and 1 died suddenly (III-2). Clinical evaluations of surviving family members demonstrated left ventricular dilation and/or dysfunction in 6 adult individuals (Figure 1Down and Table 1Down); each also had hearing loss. Audiogram profiles obtained in affected individuals showed symmetric deficits in left and right air and bone conduction (Figure 2Down). SNHL was also detected in 3 individuals (IV-1, IV-3, and IV-5) who had no echocardiographic evidence of ventricular dilation or dysfunction, although individual IV-1 had a history of clinical heart failure after intravenous hydration. The status of individual IV-6 was uncertain: this individual was 27 years old, had mild hearing deficits, and a history of frequent ear infections during childhood.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 1. Clinical and genetic status of MCE family members. Symbols half-filled on right indicate DCM; those half-filled on left indicate sensorineural hearing loss. Open symbols indicate unaffected status, and gray fill indicates unknown status. Alleles (top to bottom) are provided for loci D6S474, D6S1030, D6S1705, D6S1040, D6S262, D6S1656, D6S975, D6S1722, D6S2411, D6S292, D6S1626, and GATA184A08. 0 represents unknown allele, and * denotes haplotype that could not be reconstructed. Disease haplotype is boxed. Circles indicate females; squares, males; and a slash, deceased.


View this table:
[in this window]
[in a new window]
 
Table 1. Clinical Features of Affected Individuals



View larger version (26K):
[in this window]
[in a new window]
 
Figure 2. Audiogram from affected individual in family MCE. Hearing level is indicated in decibels (dB) and frequency in Hertz (Hz). {circ} indicates air conduction in right ear; x, conduction in left ear; and >, bone conduction.

Three of four individuals with DCM in family MDB (Figure 3Down) also had SNHL. Family history and medical records indicated hearing deficits occurred by early adulthood and preceded cardiac symptoms. Audiological evaluations were not performed on individual I-2, and her hearing phenotype was assigned unknown status. Progressive congestive cardiomyopathy characterized the DCM found in family MDB and caused the death of 2 individuals (II-1 and II-4); in one instance, death was sudden. Individual II-6 has been listed for cardiac transplantation. Significant coronary disease was excluded in some individuals by angiography (II-4, II-6) or autopsy (II-1).



View larger version (7K):
[in this window]
[in a new window]
 
Figure 3. Clinical status of family MDB. Symbols as in Figure 1Up.

The gross pathological examination of the heart specimen obtained from individual III-2 from family MCE revealed an enlarged, globular heart weighing 620 g. Histological examination demonstrated hypertrophic myocytes with enlarged hyperchromatic nuclei and increased interstitial fibrous connective tissue. Comparable findings of idiopathic DCM were described in the pathology reports of explanted hearts from individuals III-3 and III-5.

Pedigree analyses of families MCE and MDB were consistent with autosomal-dominant inheritance and age-related penetrance of SNHL (onset in second decade) with DCM (onset in fourth decade). Karyotypes of affected individuals from each family were normal (data not shown). Genome-wide linkage analyses were performed to map the disease locus in family MCE. The analysis of 280 polymorphic loci excluded >80% of the genome before linkage was identified with markers at 6q23 to 24 (Table 2Down). When the 4 young individuals (IV-1, IV-3, IV-5 and IV-6; <40 years) with SNHL but no clinical signs of cardiomyopathy were assigned an "unknown" status for linkage analyses, a maximum logarithm of odds score of 3.98 (at {theta}=0) was achieved at locus D6S2411. However, if either SNHL or DCM was used as the diagnostic criterion for disease, the maximum logarithm of odds was 4.88 (at {theta}=0), indicating a likelihood of 75 000:1 that the disease gene is encoded in this region.


View this table:
[in this window]
[in a new window]
 
Table 2. Linkage in Family MCE to Markers at 6q23 to 24

To refine the disease interval, genotypes were analyzed at nearby loci (Figure 4Down), and a disease haplotype was deduced (Figure 1Up). Recombination events were identified in 2 individuals: genotype was discordant with affection status in II-3 at D6S975 and in III-2 at D6S292, thereby defining a disease interval that spans 2.8 cM.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 4. The CMD1J disease interval spans 2.8 cM on chromosome 6q. Recombination events in affected (A) and unaffected (U) individuals from family MCE were identified by comparing affection status and genotype. White shading indicates concordance between disease status and genotype, whereas black shading indicates discordance. Hatched shading represents noninformative genotypes. Note close proximity of CMD1J to loci for hearing loss (DFNA10) and DCM (CMD1F).

Analyses of chromosome 6q23 to 24 polymorphic loci in family MDB neither proved nor excluded linkage due to the limited size of this pedigree. The disease alleles found in affected individuals of family MCE were not present in individual II-6 of family MDB, which excluded a shared disease haplotype.

Candidate Gene Analysis
The disease interval contains 7 known genes—epicardin, c-Myb, SGK, EYA4, TLP, Btf, and eRFS—and several other genes encoding expressed sequence tags. The mesenchymal basic helix-loop-helix transcription factor epicardin (also known as capsulin and Pod-1),34 35 has been mapped to a region of mouse chromosome 10 that is syntenic to human chromosome 6q23 to 24.36 Epicardin expression has been demonstrated during murine cardiac development and in interstitial cells of the adult mouse myocardium.37 We detected epicardin transcripts in human cardiac and cochlear cDNA libraries (data not shown) and amplified epicardin sequences from the overlapping yeast artificial chromosome clones 917C6 and 916H10 and P1 artificial chromosomes clone 524A10, which are contained in the disease interval. To determine if a deletion or rearrangement of the epicardin gene caused SNHL and DCM in family MCE, Southern blot analyses (after EcoR1, HindIII, and BamHI restriction enzyme digests) were performed; they were identical in DNA derived from 3 affected and 3 unaffected individuals (data not shown). DNA sequence analyses of epicardin exons and flanking splice signals, introns, and untranslated regions were performed (data not shown). A 4-bp deletion was found in a CT-rich element in the 5' untranslated region, but the deletion represented a common polymorphism that did not segregate with disease. Because some affected individuals were heterozygous for this polymorphism, the disease-causing mutation cannot be a large deletion of the entire epicardin gene. We did not detect any epicardin gene defects that could cause SNHL and DCM in affected members of family MCE.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
We report a new heritable syndrome, characterized by autosomal-dominant SNHL with DCM in 2 unrelated families and demonstrate that the causal gene(s) reside on chromosome 6q23 to 24. Cardiac disease occurred with hearing deficits; both phenotypes exhibited age-related penetrance. Early in childhood, hearing was normal, but deficits evolved throughout the school-age years and typically became overt by the second decade of life. Cardiac disease was similarly insidious in onset, but it subsequently demonstrated a rapidly progressive clinical course. Echocardiographic examinations demonstrated left-ventricular dilation with reduced systolic function by the third decade of life, but cardiac symptoms were unusual before 40 years of age. Throughout the fifth and sixth decades, heart failure was common; it necessitated transplantation or caused death in all affected individuals.

Two disease genes, DFNA1038 and CMD1F,9 map in or near the CMD1J locus. DFNA10 is responsible for deafness in affected members of several large families. Although heritable heart disease was not recognized as a feature of deafness caused by DFNA10, we cannot exclude the possibility that a different defect in the same gene or a defect in a contiguous gene could account for the cardiac defects in MCE family members. Although CMD1F mutations do cause DCM, we do not think that these loci are allelic for several reasons. (1) The disease intervals do not overlap. (2) Hearing loss has not been observed in individuals with CMD1F mutations. (3) The skeletal myopathy seen with the CMD1F mutation was not observed in our patients.

SNHL with DCM in families MCE and MDB could reflect a mutation of a single protein with important biological function in both the ear and heart, as in Jervell and Lange-Nielsen syndrome (long-QT syndrome with deafness). Mutations in K+ channel components encoded by KVLQT1 or ISK genes cause this recessive disorder. In the heart, these defects delay myocellular repolarization,39 whereas in the ear, mutations prevent the secretion of potassium into endolymph, changing the ionic environment necessary for normal hair cell function.40 Although we hypothesized that mutations in epicardin, a basic helix-loop-helix transcription factor encoded within the disease interval and expressed in cardioauditory tissues, might cause SNHL with DCM, no defects were identified. Continued analyses of genes that are coexpressed in these tissues may help explain the pleiotropic phenotypes found in families MCE and MDB.

These data extend the heterogeneity of human mutations that cause DCM. Although the incidence of hereditary cardioauditory disease is likely low, the clinical recognition and dissection of the molecular cause of this disorder has value for identifying molecules whose function is critical for cardiac biology. The late onset of disease and premature death are substantial hurdles that limit the power of molecular genetic approaches to study DCM. Indeed, genome-wide linkage analyses of the cardiac phenotype in family MCE might have been difficult. However, the recognition of hearing deficits that preceded heart disease, thus allowing SNHL to indicate affection status, significantly increased the power of genetic studies. Coexistence of disease in the myocardium and inner ear will also be of use in ongoing efforts to identify the disease gene. More immediately, recognition of the association between hearing deficits and cardiomyopathy has clinical importance. The identification of SNHL in an individual can prompt close monitoring and early intervention, practices that may ultimately reduce the high morbidity and mortality of DCM in these families.


*    Acknowledgments
 
We are indebted to the members of families MCE and MDB, without whose assistance this study would not have been possible. This work was supported by grants from the Deutsche Forschungsgemeinschaft (to J.S.), the Howard Hughes Medical Institute (to J.S., S.S., J.G.S. and C.E.S.), and the National Institutes of Health (to J.G.S. and C.E.S.) and by a Pediatric Scientist Development Award (K-12-HD 00850 to H.L.). We are grateful for the helpful comments, technical expertise, and support of Gary A. Silverman, Benoit G. Bruneau, Nahid G. Robertson, Cynthia Morton, David Conner, Barbara McDonough, Dan Fox, Vickie VanderLaan, and the Westshore Cardiology Group in Muskegon, Mich.


*    Footnotes
 
The first 2 authors contributed equally to this manuscript.

Received August 23, 1999; revision received October 27, 1999; accepted November 15, 1999.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Petit C. Genes responsible for human hereditary deafness: symphony of a thousand. Nat Genet. 1996;14:385–391.[Medline] [Order article via Infotrieve]

2. Morton NE. Genetic epidemiology of hearing impairment. Ann N Y Acad Sci. 1991;630:16–31.[Medline] [Order article via Infotrieve]

3. Reardon W. Genetic deafness. J Med Genet. 1992;29:521–526.[Free Full Text]

4. Proctor C. Diagnosis, prevention and treatment of hereditary sensorineural hearing loss. Laryngoscope. 1997;87:1–60.

5. Codd MB, Sugrue DD, Gersh BJ, Melton LJ. Epidemiology of idiopathic dilated and hypertrophic cardiomyopathy: a population-based study in Olmsted County, Minnesota, 1975–1984. Circulation. 1989;80:564–572.[Abstract/Free Full Text]

6. Michels VV, Moll PP, Miller FA, Tajik AJ, Chu JS, Discoll DJ, Burnett JC, Rodeheffer RJ, Chesebro JH, Tazelaar HD. The frequency of familial dilated cardiomyopathy in a series of patients with idiopathic dilated cardiomyopathy. N Engl J Med. 1992;326:77–82.[Abstract]

7. Keeling PJ, Gang Y, Smith G, Seo H, Bent SE, Murday V, Caforio ALP, McKenna WJ. Familial dilated cardiomyopathy in the United Kingdom. Br Heart J. 1995;73:417–421.[Abstract/Free Full Text]

8. Grünig E, Tasman JA, Kücherer H, Franz W, Kübler W, Katus HA. Frequency and phenotypes of familial dilated cardiomyopathy. J Am Coll Cardiol. 1998;31:186–194.[Abstract/Free Full Text]

9. Messina DN, Speer MC, Pericak-Vance MA, McNally EM. Linkage of familial dilated cardiomyopathy with conduction defects and muscular dystrophy to chromosome 6q23. Am J Hum Genet. 1997;61:909–917.[Medline] [Order article via Infotrieve]

10. Olson TM, Keating MT. Mapping a cardiomyopathy locus to chromosome 3p22–25. J Clin Invest. 1996;97:528–532.[Medline] [Order article via Infotrieve]

11. Kass S, MacRae C, Graber HL, Sparks EA, McNamara D, Boudoulas H, Basson CT, Baker PB III, Cody RJ, Fishman MC, Cox N, Kong A, Wooley CF, Seidman JG, Seidman CE. A genetic defect that causes conduction system disease and dilated cardiomyopathy maps to 1p1–1q1. Nat Genet. 1994;7:546–551.[Medline] [Order article via Infotrieve]

12. Durand JB, Bachinski LL, Bieling LC, Czernuszewicz GZ, Abchee AB, Yu QT, Tapscott T, Hill R, Ifegwu J, Marian AJ, Brugada R, Daiger S, Gregoritch JM, Anderson J, Quinones M, Towbin JA, Roberts R. Localization of a gene responsible for familial dilated cardiomyopathy to chromosome 1q32. Circulation. 1995;92:3384–3380.

13. Krajinovic M, Pinamonti B, Sinagra G, Vatta M, Severini GM, Milasin J, Falaschi A, Camerini F, Giacca M, Mestroni L. Linkage of familial dilated cardiomyopathy to chromosome 9. Am J Hum Genet. 1995;57:846–852.[Medline] [Order article via Infotrieve]

14. Bowles KR, Gajarski R, Porter P, Goytia V, Bachinski LL, Roberts R, Pignatelli R, Towbin JA. Gene mapping an autosomal dominant familial dilated cardiomyopathy to chromosome 10q21–23. J Clin Invest. 1996;98:1355–1360.[Medline] [Order article via Infotrieve]

15. Siu BL, Niimura H, Osborne JA, Fatkin D, MacRae C, Solomon S, Benson DW, Seidman JG, Seidman CE. Familial dilated cardiomyopathy locus maps to chromosome 2q31. Circulation. 1999;99:1022–1026.[Abstract/Free Full Text]

16. Olson TM, Michels VV, Thibodeau SN, Tai YS, Keating MT. Actin mutations in dilated cardiomyopathy, a heritable form of heart failure. Science.. 1998;280:750–752.[Abstract/Free Full Text]

17. Li D, Tapscoft T, Gonzales O, Burch PE, Quinones MA, Zoghbi WA, Hill R, Bachinski LL, Mann DL, Roberts R. Desmin mutation responsible for idiopathic dilated cardiomyopathy. Circulation.. 1999;100:461–464.[Abstract/Free Full Text]

18. Gorlin RJ, Toriello HV, Cohen MM, eds. Hereditary Hearing Loss and its Syndromes. New York: Oxford University Press; 1995:1–457.

19. Collin GB, Marshall JD, Cardon LR, Nishina PM. Homozygosity mapping at Alstrom syndrome to chromosome 2p. Hum Mol Genet. 1997;6:213–219.[Abstract/Free Full Text]

20. Michaud JL, Heon E, Guilbert F, Weill J, Puech B, Benson L, Smallhorn JF, Shuman CT, Buncic JR, Levin AV, Weksberg R, Breviere GM. Natural history of Alstrom syndrome in early childhood: onset with dilated cardiomyopathy. Pediatrics. 1996;128:225–229.

21. Santorelli FM, Mak SC, El-Schahawi M, Casali C, Shanske S, Baram TZ, Madrid RE, DiMauro S. Maternally inherited cardiomyopathy and hearing loss associated with a novel mutation in the mitochondrial tRNA(Lys) gene (G8363A). Am J Hum Genet. 1996;58:933–939.[Medline] [Order article via Infotrieve]

22. Tranchant C, Mousson B, Mohr M, Dumoulin R, Welsch M, Weess C, Stepien G, Warter JM. Cardiac transplantation in an incomplete Kearns-Sayre syndrome with mitochondrial DNA deletion. Neuromusc Disord. 1993;3:561–566.[Medline] [Order article via Infotrieve]

23. Kearns TP. External ophthalmoplegia, pigmentary degeneration of the retina, and cardiomyopathy: a newly recognized syndrome. Trans Ophthal Soc UK. 1965;63:559–625.

24. Tesson F, Denjoy I, Leibovici M, Donger C, Barhanin J, Faure S, Gary F, Coumel P, Petit C, Schwartz K, Guicheney P. A novel mutation in the potassium channel gene KVLQT1 causes the Jervell and Lange-Nielsen cardioauditory syndrome. Nat Genet. 1997;15:186–189.[Medline] [Order article via Infotrieve]

25. Schulze-Bahr E, Wang Q, Wedekind H, Haverkamp W, Chen Q, Sun Y, Rubie C, Hordt M, Towbin JA, Borggrefe M, Assmann G, Qu X, Somberg JC, Breithardt G, Oberti C, Funke H. KCNE1 mutations cause Jervell and Lange-Nielsen syndrome. Nat Genet. 1997;17:267–268.[Medline] [Order article via Infotrieve]

26. Vasan R, Larson M, Levy D, Evans J, Benjamin, E. Distribution and categorization of echocardiographic measurements in relation to reference limits the Framingham heart study: formulation of a height- and sex specific classification and its prospective validation. Circulation. 1997;6:1863–1873.

27. Monolio TA, Baughman KL, Rodeheffer R, Pearson TA, Bristow JD, Michaels V, Abelmann WH, Harlan WR. Prevalence and etiology of idiopathic dilated cardiomyopathy (summary of a national heart, lung, and blood institute workshop). Am J Cardiology. 1992;69:1458–1466.[Medline] [Order article via Infotrieve]

28. Raffin M, Thornton A. QMASS Speech Audiometry. Vol I. Minneapolis, Minn: Qualitone Inc; 1988.

29. Methods for Calculation of the Articulation Index. American National Standards Institute; 1969:S3–S5.

30. Watkins H, MacRae C, Thierfelder L, Chou YH, Frenneaux M, McKenna W, Seidman JG, Seidman CE. A disease locus for familial hypertrophic cardiomyopathy maps to chromosome 1q3. Nat Genet. 1993;3:333–336.[Medline] [Order article via Infotrieve]

31. Whitehead Mapping Project. Available at: http://www.genome.wi. mit.edu/index.html. Accessed February 29, 2000.

32. Sanger Center Chromosome 6 Mapping Group Web site. Available at: http://www.sanger.ac.uk/HGP/Chr6. Accessed February 29, 2000.

33. Genbank. Available at: http://www.ncbi.nlm.nih.gov/index.html. Accessed February 29, 2000.

34. Hidai H, Bardales R, Goodwin R, Quertermous T, Quertermous EE. Cloning of capsulin, a basic helix-loop-helix factor expressed in progenitor cells of the pericardium and the coronary arteries. Mech Dev. 1998;73:33–43.[Medline] [Order article via Infotrieve]

35. Quaggin SE, Vanden Heuvel GB, Igarashi P. Pod-1, a mesoderm-specific basic-helix-loop-helix protein expressed in mesenchymal and glomerular epithelial cells in the developing kidney. Mech Dev. 1998;71:37–48.[Medline] [Order article via Infotrieve]

36. Robb L, Mifsud L, Hartley L, Biben C, Copeland NG, Gilbert DJ, Jenkins NA, Harvey RP. Epicardin: a novel basic helix-loop-helix transcription factor gene expressed in epicardium, branchial arch myoblasts, and mesenchyme of developing lung, gut, kidney, and gonads. Dev Dyn. 1998;213:105–113.[Medline] [Order article via Infotrieve]

37. Lu J, Richardson JA, Olson EN. Capsulin: a novel bHLH transcription factor expressed in epicardial progenitors and mesenchyme of visceral organs. Mech Dev. 1998;73:23–32.[Medline] [Order article via Infotrieve]

38. O’Neill ME, Marietta J, Nishimura D, Wayne S, Van Camp G, Van Laer L, Negrini C, Wilcox ER, Chen A, Fukushima K, Ni L, Sheffield VC, Smith RJ. A gene for autosomal dominant late-onset progressive non-syndromic hearing loss, DFNA10, maps to chromosome 6. Hum Mol Genet. 1996;5:853–856.[Abstract/Free Full Text]

39. Drici MD, Arrighi I, Chouabe C, Mann JR, Lazdunski M, Romey G, Barhanin J. Involvement of IsK-associated K+ channel in heart rate control of repolarization in a murine engineered model of Jervell and Lange-Nielsen syndrome. Circ Res. 1998;83:95–102.[Abstract/Free Full Text]

40. Vetter DE, Mann JR, Wangemann P, Liu J, McLaughlin KJ, Lesage F, Marcus DC, Lazdunski M, Heinemann SF, Barhanin J. Inner ear defects induced by null mutation of the Isk gene. Neuron. 1996;17:1251–1264.[Medline] [Order article via Infotrieve]




This article has been cited by other articles:


Home page
DevelopmentHome page
L. Wang, W. F. Sewell, S. D. Kim, J. T. Shin, C. A. MacRae, L. I. Zon, J. G. Seidman, and C. E. Seidman
Eya4 regulation of Na+/K+-ATPase is required for sensory system development in zebrafish
Development, October 15, 2008; 135(20): 3425 - 3434.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
L. Zhang, A. Hu, H. Yuan, L. Cui, G. Miao, X. Yang, L. Wang, J. Liu, X. Liu, S. Wang, et al.
A Missense Mutation in the CHRM2 Gene Is Associated With Familial Dilated Cardiomyopathy
Circ. Res., June 6, 2008; 102(11): 1426 - 1432.
[Abstract] [Full Text] [PDF]


Home page
Eur J Heart FailHome page
I. Portig, A. Wilke, M. Freyland, M.-J. Wolf, A. Richter, V. Ruppert, S. Pankuweit, and B. Maisch
Familial inflammatory dilated cardiomyopathy
Eur J Heart Fail, December 1, 2006; 8(8): 816 - 825.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
E. L. Burkett and R. E. Hershberger
Clinical and genetic issues in familial dilated cardiomyopathy
J. Am. Coll. Cardiol., April 5, 2005; 45(7): 969 - 981.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
S A Mohiddin, Z M Ahmed, A J Griffith, D Tripodi, T B Friedman, L Fananapazir, and R J Morell
Novel association of hypertrophic cardiomyopathy, sensorineural deafness, and a mutation in unconventional myosin VI (MYO6)
J. Med. Genet., April 1, 2004; 41(4): 309 - 314.
[Full Text] [PDF]


Home page
SEMIN CARDIOTHORAC VASC ANESTHHome page
P. A. Doevendans
Genetic Polymorphisms and Cardiac Failure
Seminars in Cardiothoracic and Vascular Anesthesia, March 1, 2003; 7(1): 23 - 29.
[PDF]


Home page
Physiol. Rev.Home page
D. Fatkin and R. M. Graham
Molecular Mechanisms of Inherited Cardiomyopathies
Physiol Rev, October 1, 2002; 82(4): 945 - 980.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
K. A. Crispell, E. L. Hanson, K. Coates, W. Toy, and R. E. Hershberger
Periodic rescreening is indicated for family members at risk of developing familial dilated cardiomyopathy
J. Am. Coll. Cardiol., May 1, 2002; 39(9): 1503 - 1507.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
K. F. Benson and K. Chada
Molecular Characterization of the Mouse In(10)17Rk Inversion and Identification of a Novel Muscle-Specific Gene at the Proximal Breakpoint
Genetics, January 1, 2002; 160(1): 279 - 287.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
S. Wayne, N. G. Robertson, F. DeClau, N. Chen, K. Verhoeven, S. Prasad, L. Tranebjarg, C. C. Morton, A. F. Ryan, G. Van Camp, et al.
Mutations in the transcriptional activator EYA4 cause late-onset deafness at the DFNA10 locus
Hum. Mol. Genet., February 1, 2001; 10(3): 195 - 200.
[Abstract] [Full Text] [PDF]


Home page
HeartHome page
M KOMAJDA
Genetics of dilated cardiomyopathy: a molecular maze?
Heart, November 1, 2000; 84(5): 463 - 464.
[Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schönberger, J.
Right arrow Articles by Seidman, C. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schönberger, J.
Right arrow Articles by Seidman, C. E.
Related Collections
Right arrow Congestive
Right arrow Heart failure - basic studies
Right arrow Myocardial cardiomyopathy disease
Right arrow Genetics of cardiovascular disease