Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation
Search: search_blue_button Advanced Search
Circulation. 1999;100:1639-1645

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, G.
Right arrow Articles by Thompson, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, G.
Right arrow Articles by Thompson, J. A.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*ESTRADIOL
*TEFLON
Related Collections
Right arrow Animal models of human disease
Right arrow Smooth muscle proliferation and differentiation
Right arrow Receptor pharmacology

(Circulation. 1999;100:1639-1645.)
© 1999 American Heart Association, Inc.


Basic Science Reports

Estrogen Inhibits Vascular Smooth Muscle Cell–Dependent Adventitial Fibroblast Migration In Vitro

Guohong Li, MD, PhD; Yiu-Fai Chen, PhD; Geoffrey L. Greene, PhD; Suzanne Oparil, MD; John A. Thompson, PhD

From the University of Alabama at Birmingham, Departments of Medicine, Vascular Biology and Hypertension Program, and Surgery, Division of Transplantation; and the Ben May Institute for Cancer Research, University of Chicago (G.L.G.), Chicago, Ill.

Correspondence to John A. Thompson, PhD, 752 Lyons Harrison Research Bldg, 701 S 19th St, Birmingham, AL 35294-0007. E-mail athompson{at}ms.surgery.uab.edu


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Background—Mounting experimental evidence suggests that estrogen treatment protects against neointima formation in response to vascular injury in vivo. Previous studies have suggested that this process includes the activation and migration of adventitial fibroblasts. The present in vitro study was designed to establish a mechanism whereby estrogen attenuates migration of adventitial fibroblasts.

Methods and Results—Primary cultures of vascular smooth muscle cells (VSMCs) and adventitial fibroblasts were derived from female Sprague-Dawley rats. Reverse transcriptase–polymerase chain reaction and Western blotting were used to determine that expression of the estrogen receptor (ER) was restricted to early-passage VSMCs. Migration of transduced (retrovirally mediated) fibroblasts was determined by counting the number of blue lacZ-expressing cells attached to Boyden-type chambers preconditioned under defined experimental conditions. Compared with growth medium alone, chambers treated with medium conditioned by VSMCs demonstrated a 2-fold increase in fibroblast migration, suggesting that VSMCs release soluble factor(s) competent to bind the Transwell membrane and promote fibroblast migration. In contrast, treatment of VSMCs with 17ß-estradiol (10-9 to 10-7 mol/L) before preconditioning of the chamber induced a dose-dependent inhibition of fibroblast migration. Cotreatment of VSMCs with 17ß-estradiol and the ER antagonist ICI-182780 (10-7 mol/L) blocked the inhibitory effect of estrogen on fibroblast migration.

Conclusions—These observations suggest a novel mechanism of hormonal vasoprotection by which estrogen directly modulates VSMC expression of factor(s) controlling migration of adventitial fibroblasts via an ER-dependent mechanism.


Key Words: hormones • cells • muscle, smooth • arteries • restenosis


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Participation of the adventitia in the response to vascular injury has been suggested by pathological findings of adventitial activation (inflammation and fibrosis) in coronary arteries of victims of fatal coronary artery disease.1 2 In some individuals who died suddenly at an early age, adventitial inflammation appeared to antedate intimal disease.1 Furthermore, neointima formation and/or atherosclerotic lesions have been observed in response to adventitial injury in various animal models,3 4 raising the possibility of alternative pathways of the vascular injury response. More recently, endoluminal injury of a porcine coronary artery was shown to result in significant remodeling of the adventitia.5 Activated adventitial cells were suggested to migrate into the neointima and transform into a myofibroblast phenotype.6 These findings predict that adventitial fibroblasts may play an important role after vascular injury.

A variety of animal models have demonstrated the inhibitory effects of estrogen on the vascular injury response. The balloon-injured rat carotid artery model has been used extensively in our own laboratory to study this issue.7 8 Early preliminary studies with this model have suggested that estrogen treatment attenuates both adventitial activation and the potential translocation of adventitial fibroblasts into medial and neointimal compartments. The present in vitro study was designed to provide insight into potential cellular and molecular mechanisms of adventitial cell migration that could be induced by endoluminal vascular injury and inhibited by estrogen. Primary cultures of adventitial fibroblasts from female rat carotid arteries were derived, characterized, and evaluated for their migratory behavior in response to conditioned medium from vascular smooth muscle cells (VSMCs) pretreated in the presence and absence of estrogen. Several lines of evidence suggest that estrogen indirectly attenuates fibroblast migration after estrogen receptor (ER)-dependent modulation of VSMC release of a soluble chemoattractant factor(s).


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Cell Culture and Transduction
Primary VSMCs were prepared from the thoracic aorta of intact 10-week-old female Sprague-Dawley rats.9 The adventitial layer of aorta was dissected away with a scalpel blade, and the endothelium was removed with a cotton swab. The tissue explants were incubated in DMEM (Life Technologies) supplemented with 10% (vol/vol) heat-inactivated FBS (Hyclone), 4 mmol/L L-glutamine, 100 U/mL penicillin, and 100 µg/mL streptomycin (complete medium). This medium did not contain phenol red because of the recognized estrogenic effects of this compound. VSMCs were allowed to grow out from the tissue, which was removed after 8 to 10 days. Population doublings were monitored, and unless otherwise indicated, only early, stabilized passages (from 3 to 6) were used for these studies.

Primary adventitial fibroblasts were recovered from the carotid arteries of intact female Sprague-Dawley rats by use of a solid support consisting of nonwoven, multifilament, angel-hair fibers of expanded polytetrafluoroethylene (PTFE) prepared as described.10 11 These fibers were surgically implanted into the neck cavity of the rat, adjacent to the carotid adventitia. Two to 3 weeks after implantation, the visible PTFE sponge was surgically removed and digested with collagenase to recover resident cells.10 11 Explanted cells were seeded and expanded in culture with complete medium.

Subconfluent (70% to 80%) primary adventitial fibroblasts (passage 3 to 4) were treated with retroviral particles encoding ß-galactosidase (lacZ) as described.12 Transduced adventitial fibroblasts were isolated by fluorescence-activated cell sorter (FACS), plated, and expanded in complete medium for subsequent analyses. Expression of lacZ was monitored with the chromogenic substrate Bluo-gal.

In Situ Immunohistochemical Analysis
VSMCs and adventitial fibroblasts were seeded (1x104 cells) onto glass coverslips and allowed to attach (16 hours) in complete medium. Attached cells were washed in PBS and maintained (48 hours) under normal culture conditions. Cells were fixed (15 minutes) in 4% (vol/vol) phosphate-buffered formalin and incubated (15 minutes) with 1% (vol/vol) H2O2 in methanol. Fixed cells were washed with 50 mmol/L Tris-HCl (pH 7.5) containing 0.1 mol/L NaCl and 0.05% (vol/vol) Tween 20 (TTBS) and incubated (37°C, 45 minutes) in a humidified chamber with specific monoclonal and polyclonal antibodies (Table 1Down) diluted in TTBS according to the manufacturers' recommendations (Boehringer Mannheim, Serotec, Dako, Novacastra Laboratories, Sigma, Calbiochem, ICN). Antibody binding was detected with a Quick Staining Kit (Dako) using either swine anti-rabbit or swine anti-mouse horseradish peroxidase (HRP)–conjugated secondary antibodies. Peroxidase-stained samples were developed with 0.5 mg/mL 3,3'-diaminobenzidine and counterstained with Mayer's hematoxylin (Sigma). Chromogenic development of stained samples permitted analysis of positive brown staining by light microscopy. Four coverslips per antibody staining of individual cell populations were analyzed, and >=5 fields ({approx}250 cells) per coverslip were counted.


View this table:
[in this window]
[in a new window]
 
Table 1. Immunohistochemical Characterization of Primary VSMCs and Adventitial Cells Maintained Under Normal Growth Conditions

Measurement of NADPH and NADH Oxidase Activity
Confluent VSMCs and adventitial fibroblasts were washed in PBS and pretreated (4 hours) with serum-free DMEM in the absence or presence of 10-7 mol/L angiotensin II. Treated cells were washed (PBS), scrape-harvested in 15 mL ice-cold PBS, and centrifuged (10 minutes, 4°C) at 1500 rpm. Pelleted cells were resuspended and prepared by Dounce homogenization in 1.0 mL lysis buffer (4°C) containing protease inhibitors (20 mmol/L potassium phosphate [pH 7.0], 1 mmol/L EGTA, 10 µg/mL aprotinin, 0.5 µg/mL leupeptin, 0.7 µg/mL pepstatin, and 0.5 mmol/L phenylmethylsulfonyl fluoride). Protein concentration was determined by the Bradford assay (Pierce). NADPH and NADH oxidase activities were measured by a modified luminescence assay13 in 50 mmol/L phosphate buffer (pH 7.0) containing 1 mmol/L EGTA, 150 mmol/L sucrose, 100 µmol/L of either NADPH or NADH, and cellular homogenate (20 to 40 µg total protein). The reaction was initiated by the addition of 150 µL of lucigenin (final concentration 500 µmol/L). Photon emission from reduced lucigenin was measured every 15 seconds with a 5-second delay in a luminometer (model Optocomp I). NADPH and NADH oxidase activities were expressed by relative light units and normalized to protein content of each sample run in quadruplicate.

Nucleic Acid Extraction and Analysis
Total RNA was analyzed by reverse transcriptase–polymerase chain reaction (RT-PCR) techniques under previously established conditions.12 Synthetic DNA amplimers specific for rat ER-{alpha} were sense, AATTCTGACAATCGACGCCAG and antisense, GTGCTTCAACATTCTCCCTCCTC. Synthetic DNA amplimers specific for rat GAPDH were sense, TGAAGGTCGGTGTGAACGGATTTGGC and antisense, CATGTAGGCCATGAGGTCCACCAC. RT-PCR products were analyzed by 2% (wt/vol) agarose gel electrophoresis. After electrophoresis, amplification products were stained with ethidium bromide, visualized with UV light, and standardized to levels of amplified GAPDH mRNA.12

Protein Extraction and Western Analysis
Whole-cell extracts of rat VSMCs, adventitial fibroblasts, and human breast cancer cells (MCF-7) were prepared by releasing cells from monolayer cultures with 2x SDS gel sample buffer (4% wt/vol SDS, 12% wt/vol sucrose, 10% vol/vol ß-mercaptoethanol, 0.125 mol/L Tris [pH 6.8], and 0.05% wt/vol bromophenol blue). All samples were sonicated for 1 second and heated at 90°C for 5 minutes before electrophoresis. Proteins were fractionated under reducing conditions by routine 10% (wt/vol) SDS-PAGE. Resolved proteins were transferred electrophoretically to nitrocellulose membranes (Amersham), which were probed (1 hour) with purified ER-21 (0.5 µg/mL) in the presence or absence of a 50-fold molar excess of a synthetic HER1–21 peptide14 and followed by HRP–conjugated goat anti-rabbit IgG (1:2000 dilution, Sigma). Immunoreactive bands were visualized by treatment with ECL Western blotting detection reagents (Amersham) according to the manufacturer's instructions.

Cell Migration
VSMCs (8x104 cells/well) were seeded in 24-well plates (Costar) in complete medium and grown to 70% to 80% confluence (Figure 1ADown). Subconfluent VSMCs were washed in PBS, fed DMEM containing 5% (vol/vol) FBS, and maintained for 24 hours (Figure 1BDown). Where experimentally indicated, the medium contained 17ß-estradiol (10-9 to 10-7 mol/L) or vehicle (0.01% ethanol). To determine an ER-dependent effect, VSMCs were pretreated (4 hours) with the estrogen antagonist ICI-182780 (10-7 to 10-5 mol/L) or vehicle (0.01% ethanol) before 17ß-estradiol exposure. VSMC-conditioned medium was added to a new well and incubated (16 hours) with a Transwell insert (8-µm pores) that had been precoated (16 hours) with 0.1% (wt/vol) gelatin (Figure 1CDown). The conditioned Transwell chamber was moved to a separate well containing 0.7 mL DMEM supplemented with 0.1% (wt/vol) BSA (Figure 1DDown).



View larger version (12K):
[in this window]
[in a new window]
 
Figure 1. Schematic depicting protocol for assessing adventitial fibroblast migration in 2-well Boyden-type chambers.

Transduced adventitial fibroblasts were grown to 70% to 80% confluence in complete medium, washed (PBS) twice, detached with 0.1% (wt/vol) trypsin, and resuspended (1.5x105 cells/mL) in DMEM supplemented with 0.1% (wt/vol) BSA. A suspension (0.2 mL) of transduced fibroblasts was pipetted into the conditioned Transwell chamber and incubated (4 hours) at 37°C (Figure 1DUp). After incubation (Figure 1EUp), nonmigratory fibroblasts were removed carefully from the upper face of the Transwell chambers with a cotton swab. Transwell membranes were fixed in 0.2% (vol/vol) glutaraldehyde and stained with the chromogenic substrate Bluo-gal. LacZ-expressing (blue) fibroblasts that had migrated and adhered to the Transwell membrane were microscopically counted. In all cases, 4 separate high-power fields were counted per membrane, and all experiments were run in duplicate.

Cell Adhesion
VSMCs and adventitial fibroblasts were seeded in 24-well plates in complete medium and grown to 70% to 80% confluence. Subconfluent cells were washed (PBS), fed DMEM containing either 5% (vol/vol) or 0.5% (vol/vol) FBS in the presence or absence of 10-8 mol/L 17ß-estradiol, and maintained (24 hours) at 37°C. Media conditioned by individual cell populations under defined experimental conditions (n=5/condition) were collected separately. Aliquots (100 µL/well) of conditioned medium were added to individual wells of 96-well cluster plates and incubated (16 hours) at 4°C. Each treated well was washed gently with adhesion assay buffer (140 mmol/L NaCl, 5.4 mmol/L KCl, 1 mmol/L CaCl2, 1 mmol/L MgCl2, 0.5 mmol/L MnCl2, 5.56 mmol/L D-glucose, 10 mmol/L HEPES [pH 7.4], and 1% wt/vol BSA), and nonspecific binding sites were blocked (1 hour, 37°C) with 1% (wt/vol) BSA.

VSMCs and adventitial fibroblasts were grown to 70% to 80% confluence in complete medium, washed, detached with 0.1% (wt/vol) trypsin, and resuspended (4x105 cells/mL) in adhesion assay buffer. A suspension (0.1 mL) of cells was pipetted into individual wells previously treated with conditioned medium and incubated (45 minutes; 37°C). Nonadherent cells were removed by washing (PBS) and swabbing of the sides of the well. Adherent cells were fixed with 4% (vol/vol) paraformaldehyde and stained with 1% (wt/vol) crystal violet, followed by air-drying and extraction with 10% (vol/vol) acetic acid. Dye uptake was quantified by an ELISA plate reader, and results were determined as the mean total absorbance at 570 nm.

Statistical Analysis
Within each in vitro experiment, cells were matched for lineage, population doublings, and days before or after confluence to avoid differences related to cell culture variables. Statistical analyses were carried out with the Crunch statistical package on an IBM-compatible personal computer. Our primary statistical test was multivariate ANOVA. Differences in mean values due to main effects and their interactions were tested, with a value of P<0.05 considered statistically significant.15


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
The fiber implant presumably signals the proximal cells of the tunica adventitia, which migrate into the implant site and produce molecular products competent to orchestrate relevant biological cascades reflective of typical wound healing.10 11 Histological examination of the fiber implant itself suggests that this response is composed of cells recruited from the host in which by 14 to 21 days after implantation, the entire fiber bundle is permeated with invading fibroblasts, which dominate the implant stroma. Consequently, it was reasoned that surgical removal of the fiber implants at this time would provide an explant enriched in adventitial cells.

Microscopic examination was used to compare morphological appearances of expanded populations of VSMCs and adventitial fibroblasts derived from their respective explants. Primary VSMCs displayed a typical monolayer phenotype exhibiting a characteristic hill-and-valley growth pattern. In contrast, stromal fibroblasts displayed a spindle-like, bipolar and tripolar morphology exhibiting small processes at each pole and a smooth cell border. Compared with primary VSMCs (doubling time=27.7 hours), primary adventitial fibroblasts (doubling time=19.4 hours) exhibited a growth advantage under normal culture conditions. In situ immunohistochemical analysis (Table 1Up) of both primary cell populations failed to demonstrate the appearance of cells with either endothelial (vWF, QBEnd/40, UEA-1), lymphatic (MAC-1, ED-1, CD5), epithelial (NCL-EMA, cytokeratin), or mesothelial (HBME-1) markers. Instead, expanded populations of both VSMCs and adventitial cells demonstrated positive staining for markers (vimentin, {alpha}-SM actin, actin, HHF35, myosin) typically found in smooth muscle cells but often shared with fibroblasts. After expansion in culture, activated adventitial fibroblasts failed to demonstrate expression of desmin, an observation consistent with previous efforts.6

Both VSMCs and adventitial fibroblasts exhibited NADH and NADPH oxidase activities, each of which was stimulated (>1.4-fold) after treatment with angiotensin II (Table 2Down). Compared with NADPH oxidase activity, both VSMCs (>7-fold) and adventitial fibroblasts (>9-fold) demonstrated significantly higher levels of NADH oxidase activity. However, compared with VSMCs, adventitial fibroblasts consistently demonstrated significantly higher levels of both NADPH (>2-fold) and NADH (>2.5-fold) oxidase activity. Collectively, these results are consistent with previous studies.13 16 17


View this table:
[in this window]
[in a new window]
 
Table 2. In Vitro Superoxide-Generating Activity of Primary Rat VSMCs and Adventitial Fibroblasts in the Presence of NADPH or NADH

To rigorously track the migratory behavior of adventitial fibroblasts, primary cells were transduced, selected by 2 rounds of FACS, and expanded for biochemical analyses. This approach routinely resulted in an adventitial fibroblast preparation in which >95% of the cells expressed readily detectable levels of lacZ. Compared with primary adventitial fibroblasts, transduced cells exhibited a similar phenotype, growth behavior, expression of characteristic markers (Table 2Up), and high angiotensin II–inducible levels of NADPH/NADH oxidase. At least 4 separate explant preparations of primary and transduced fibroblast populations were examined, and each provided consistent results.

A characteristic RT-PCR product (344 bp) was identified for the ER-{alpha} gene in early passages (from 3 to 6) of VSMCs (Figure 2Down). Late passages (from 13 to 18) of VSMCs lost their ability to express ER-{alpha} mRNA. Early-passage nontransduced and transduced adventitial fibroblasts both failed to demonstrate detectable expression of ER-{alpha} mRNA (Figure 2Down). Early passages of VSMCs expressed readily detectable cellular levels of immunoreactive ER-{alpha} protein with an apparent molecular mass of {approx}65 kDa (Figure 3Down). In contrast, transduced adventitial fibroblasts failed to express ER-{alpha} protein. Western analysis of late-passage VSMCs and nontransduced adventitial fibroblasts failed to demonstrate the appearance of immunoreactive ER-{alpha} protein (data not shown). Collectively, these results are consistent with RT-PCR analyses and confirm that expression of ER-{alpha} mRNA and protein is restricted to early passages of primary rat VSMCs.



View larger version (52K):
[in this window]
[in a new window]
 
Figure 2. Steady-state levels of ER-{alpha} mRNA in individual cell populations (A) were standardized to levels of GAPDH mRNA from identical samples (B). Each gel contained a 1.0-kb-pair DNA ladder (lane 1). RT-PCR analyses were performed on early passages of VSMCs (lane 2), late passages of VSMCs (lane 3), early passages (3 to 4) of nontransduced adventitial fibroblasts (lane 4), and lacZ-transduced adventitial fibroblasts (lane 5). RNA recovered from rat ovary (lane 6) and uterus (lane 7) served as a positive control.



View larger version (67K):
[in this window]
[in a new window]
 
Figure 3. Western analysis for expression of ER-{alpha} protein. Proteins harvested from total cellular extracts of early-passage rat VSMCs (lane 4) and transduced rat adventitial fibroblasts (lane 3) were analyzed (left) by use of a polyclonal antibody against ER-{alpha}. Pretreatment of ER-21 with synthetic amino-terminal peptide antigen (HER1–21) completely abrogated immunostaining (right). Proteins harvested from total extracts of human breast cancer cells (MCF-7) served as positive controls (lanes 1 and 2). Approximate size of ER-{alpha} immunoreactive polypeptide was estimated by use of prestained standards (MWM, kDa).

Transduced, lacZ-expressing fibroblasts demonstrated minimal migration to Transwell membranes preconditioned with serum-free medium (Figure 4ADown). Preconditioning of the membrane with complete medium increased the number of migrating transduced fibroblasts. Treatment of the Transwell membrane with medium conditioned by VSMCs induced a statistically significant (P<0.01), nearly 2-fold increase in the number of migrating fibroblasts. Treatment of VSMCs with 17ß-estradiol inhibited adventitial fibroblast migration in a dose-dependent manner over the range of 10-9 to 10-7 mol/L. Addition of 17ß-estradiol (10-7 mol/L) to medium conditioned by late-passage VSMCs had no effect on adventitial fibroblast migration. Furthermore, there was no evidence of lacZ-expressing cells either in the culture medium of the lower chamber or attached to the bottom of the lower chamber.



View larger version (41K):
[in this window]
[in a new window]
 
Figure 4. A, Migration of fibroblasts associated with Transwell membranes treated in presence (+) and absence (-) of complete medium (5% FBS), VSMC conditioning, and various doses (10-7 to 10-9 mol/L) of 17ß-estradiol (E2). **Differential significance of P<0.01 vs results shown by bar 3. B, Migration of fibroblasts associated with Transwell membranes treated with medium conditioned by VSMCs in presence (+) of 10-8 mol/L 17ß-estradiol (E2) and various concentrations (10-5 to 10-7 mol/L) of ER antagonist ICI-182780. Differential significance of *P<0.05 and **P<0.01 vs results shown by bar 2.

The inclusion of the selective ER antagonist ICI-182780 (10-6 mol/L) alone in medium conditioned by VSMCs had no effect on fibroblast migration (Figure 4BUp). However, pretreatment of VSMCs with the ER antagonist produced a dose-dependent inhibition of the estradiol effect, such that a 100-fold molar excess completely abrogated the ability of 10-8 mol/L 17ß-estradiol to attenuate VSMC-induced migration of adventitial fibroblasts. 17ß-Estradiol (10-7 to 10-9 mol/L) pretreatment of ER-negative adventitial fibroblasts had no effect on their migration (Figure 5Down). In addition, medium conditioned by primary adventitial fibroblasts, treated in the presence or absence of 10-8 mol/L 17ß-estradiol, had no effect on fibroblast migration (Figure 5BDown).



View larger version (16K):
[in this window]
[in a new window]
 
Figure 5. A, Migration of fibroblasts associated with Transwell membranes treated with medium conditioned by VSMCs in absence (-) and presence (+) of 10-8 mol/L 17ß-estradiol (E2). Bars 3 to 5, Transduced adventitial fibroblasts were directly pretreated with various concentrations (10-7 to 10-9 mol/L) of 17ß-estradiol before incubation in migration chamber. B, Migration of fibroblasts associated with Transwell membranes treated with complete medium alone (bar 1) or complete medium conditioned by primary adventitial fibroblasts (bars 2 and 3) in absence (-) or presence (+) of 10-8 mol/L 17ß-estradiol (E2).

The migration assay alone does not determine whether the ER-dependent estrogen effect is on chemotaxis or attachment or both. Consequently, we investigated primary cell adhesion to medium conditioned by either VSMCs or adventitial fibroblasts in the absence or presence of 10-8 mol/L 17ß-estradiol (Figure 6Down). Compared with preconditioning with serum-free medium, treatment of plates with medium conditioned by VSMCs induced a significant increase in the number of adhering fibroblasts (Figure 6ADown) or VSMCs (Figure 6BDown). Likewise, treatment of plates with medium conditioned by adventitial fibroblasts induced a significant increase in the number of adhering fibroblasts or VSMCs. Inclusion of 10-8 mol/L 17ß-estradiol during medium preconditioning had no significant effect on either fibroblast or VSMC adhesion regardless of the cellular source of attachment factors.



View larger version (24K):
[in this window]
[in a new window]
 
Figure 6. Adhesion of fibroblasts (A) or VSMCs (B) to plates treated in absence (-) or presence of defined serum (FBS) concentration, conditioned (+) by either VSMCs or fibroblasts in absence (-) or presence of 10-8 mol/L 17ß-estradiol (E2).


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
This study provides a first indication that adventitial fibroblasts in vitro have the capability to migrate in response to a soluble factor(s) secreted by activated VSMCs and that estrogen indirectly inhibits this process in a dose- and ER-dependent manner. These findings suggest a cellular mechanism for the previous observations that adventitial cells are activated and migrate into neointima after in vivo endoluminal injury. Whether the signaling pathway responsible involves diffusion of chemoattractant/mitogenic factors from damaged VSMCs through the medium and external elastic lamina to the adventitia and/or delivery of circulating mediators to the adventitia via the vasa vasorum is uncertain.

Evidence that fibroblasts can serve as targets for chemoattractant/growth factors comes mainly from studies of wound healing.18 19 20 21 The wound-healing process is associated with early activation of fibroblasts, which subsequently proliferate, migrate, and differentiate into myofibroblasts. Similar cellular responses have been described in a variety of other pathological conditions associated with fibrogenesis and organ remodeling.21 22 23 24 Accordingly, it has been hypothesized that this fibroblast response is a general feature of tissue repair and therefore may also occur during vascular injury.21 The observation that "nonmuscle" cells are found in the media of large arteries and veins of the dog and have a higher proliferative capacity than VSMCs25 has questioned the traditional belief that undifferentiated VSMCs are entirely responsible for neointima formation in injured blood vessels.26

Systemic estrogen influences the development of intraperitoneal scarring by suppressing connective tissue formation in a murine model of peritoneal adhesion formation.27 In contrast, postmenopausal hormone replacement therapy increases the dermal content of collagen and limits age-related increases in skin extensibility.28 In vitro studies have shown that estrogen influences processes critical to wound repair, such as cellular proliferation and cytokine production.29 30 Furthermore, there is evidence that the estrogen effect on wound healing may be mediated by the action of estrogen-stimulated cytokine release.30 These studies suggested that estrogen provided an indirect effect on dermal fibroblasts by stimulating responses in other cell types invading the wound site. In studies reported here, a similar indirect effect of estrogen is suggested by which ER-dependent modulation of VSMC release of a soluble factor(s) attenuates adventitial fibroblast migration. Additional in vitro and in vivo efforts will be necessary to identify the soluble factor(s) involved in this hormone-mediated vasoprotective process.


*    Acknowledgments
 
This work was supported in part by grants HL-07457, HL-45990, and HL-52070 from the National Heart, Lung, and Blood Institute and a Grant-in-Aid (9750665N) from the American Heart Association. The authors thank Marla Kolarik for her assistance in the preparation of the manuscript and Danielle Barstad for her technical assistance in the Western blotting experiments.

Received January 27, 1999; revision received May 27, 1999; accepted June 2, 1999.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Saphir O, Gore I. Evidence for an inflammatory basis of coronary arteriosclerosis in the young. Arch Pathol. 1950;49:418–426.

2. Kohchi K, Takebayashi S, Hiroki T, Nobuyoshi M. Significance of adventitial inflammation of the coronary artery in patients with unstable angina: results at autopsy. Circulation. 1985;71:709–716.[Abstract/Free Full Text]

3. Prescott MF, McBride CK, Court M. Development of intimal lesions after leukocyte migration into the vascular wall. Am J Pathol. 1989;135:835–846.[Abstract]

4. Beesley JE, Honey AC, Martin JF. Ultrastructural assessment of lesion development in the collared rabbit carotid artery model. Cells Mater. 1992;2:201–208.

5. Shi Y, Pieniek M, Fard A, O'Brien JE, Mannion JD, Zalewski A. Adventitial remodeling following coronary arterial injury. Circulation. 1996;93:340–348.[Abstract/Free Full Text]

6. Shi Y, O'Brien JE, Fard A, Mannion JD, Wang D, Zalewski A. Adventitial myofibroblasts contribute to neointimal formation in injured porcine coronary arteries. Circulation. 1996;94:1655–1664.[Abstract/Free Full Text]

7. Chen SJ, Li H, Durand J, Oparil S, Chen YF. Estrogen reduces myointimal proliferation after balloon injury of rat carotid artery. Circulation. 1996;93:577–584.[Abstract/Free Full Text]

8. Oparil S, Levine RL, Chen SJ, Durand J, Chen YF. Sexually dimorphic response of the balloon-injured rat carotid artery to hormone treatment. Circulation. 1997;95:1301–1307.[Abstract/Free Full Text]

9. Ross R. Growth of smooth muscle cell in culture and formation of elastic fibers. J Cell Biol. 1971;50:172–186.[Abstract/Free Full Text]

10. Thompson JA, Haudenschild CC, Anderson KD, DiPietro JM, Anderson WF, Maciag T. Heparin-binding growth factor 1 induces the formation of organoid neovascular structures in vivo. Proc Natl Acad Sci U S A. 1989;86:7928–7932.[Abstract/Free Full Text]

11. Thompson JA, Anderson KD, DiPietro JM, Zwiebel JA, Zametta M, Anderson WF, Maciag T. Site-directed neovessel formation in vivo. Science. 1988;241:1349–1352.[Abstract/Free Full Text]

12. Opalenik SR, Shin JT, Wehby JN, Mahesh VK, Thompson JA. The HIV-1 TAT protein induces the expression and extracellular appearance of acidic fibroblast growth factor. J Biol Chem. 1995;270:1745–1746.

13. Griendling KK, Minieri CA, Ollerenshaw JD, Alexander RW. Angiotensin II stimulates NADH and NADPH oxidase activity in cultured vascular smooth muscle cells. Circ Res. 1994;74:1141–1148.[Abstract/Free Full Text]

14. Hess RA, Gist DH, Bunick D, Lubahn DB, Farrell A, Bahr J, Cooke PS, Greene GL. Estrogen receptor ({alpha} and ß) expression in the excurrent ducts of the adult male rat reproductive tract. J Androl. 1997;18:602–611.[Abstract/Free Full Text]

15. Milliken GA, Johnson DE, eds. Analysis of Messy Data: Design Experiments (Vol 1). New York, NY: Van Nostrand Reinhold, 1984.

16. Pagano PJ, Chanock SJ, Siwik DA, Colucci WS, Clark JK. Angiotensin II induces p67phox mRNA expression and NADPH oxidase superoxide generation in rabbit aortic adventitial fibroblasts. Hypertension. 1998;32:331–337.[Abstract/Free Full Text]

17. Pagano PJ, Clark JK, Cifuentes-Pagano ME, Clark SM, Callis M, Quinn MT. Localization of a constitutively active, phagocyte-like NADPH oxidase in rabbit aortic adventitia: enhancement by angiotensin II. Proc Natl Acad Sci U S A. 1997;94:14483–14488.[Abstract/Free Full Text]

18. Gabbiani G, Ryan GB, Majno G. Presence of modified fibroblasts in granulation tissue and their possible role in wound contraction. Experientia. 1971;27:549–550.[Medline] [Order article via Infotrieve]

19. Darby I, Skalli O, Gabbiani G. {alpha}-Smooth muscle actin is transiently expressed by myofibroblasts during experimental wound healing. Lab Invest. 1990;63:21–29.[Medline] [Order article via Infotrieve]

20. Zalewski A, Shi Y. Vascular myofibroblasts: lessons from coronary repair and remodeling. Arterioscler Thromb Vasc Biol. 1997;17:417–422.[Free Full Text]

21. Kapanci Y, Burgan S, Pietra GG, Conne B, Gabbiani G. Modulation of actin isoform expression in alveolar myofibroblasts (contractile interstitial cells) during pulmonary hypertension. Am J Pathol. 1990;136:881–889.[Abstract]

22. Johnson RJ, Lida H, Alpers CE, Majesky MW, Schwartz SM, Pritzi P, Gordon K, Gown AM. Expression of smooth muscle cell phenotype by rat mesangial cells in immune complex nephritis: {alpha}-smooth muscle actin is a marker of mesangial cell proliferation. J Clin Invest. 1991;87:847–858.

23. Willems IEMG, Hevenith MH, De Mey JGR, Daemen MJAP. The {alpha}-smooth muscle cells in healing human myocardial scars. Am J Pathol. 1994;145:868–875.[Abstract]

24. Holifield B, Helgason T, Jemelka S, Taylor A, Navran S, Allen J, Seidel C. Differentiated vascular myocytes: are they involved in neointimal formation? J Clin Invest. 1996;97:814–825.[Medline] [Order article via Infotrieve]

25. Schwartz SM, Reidy MA, Clowes AW. Kinetics of atherosclerosis: a stem cell model. Ann N Y Acad Sci. 1985;454:292–294.[Medline] [Order article via Infotrieve]

26. Frazier-Jensen MR, Mott FJ, Witte PL, Kovacs EJ. Estrogen suppression of connective tissue deposition in a murine model of peritoneal adhesion formation. J Immunol. 1996;156:3036–3042.[Abstract]

27. Pierard GE, Letawe C, Dowlati A, Pierard-Franchimont C. Effect of hormone replacement therapy for menopause on the mechanical properties of the skin. J Am Geriatr Soc. 1995;43:662–665.[Medline] [Order article via Infotrieve]

28. Oursler MJ, Cortese C, Keeting P, Anderson MA, Bonde SK, Riggs BL, Spelsberg TC. Modulation of transforming growth factor-beta production in normal human osteoblast-like cells by 17 beta-estradiol and parathyroid hormone. Endocrinology. 1991;129:3313–3320.[Abstract/Free Full Text]

29. Piccinni MP, Giudizi MG, Biagiotti R, Beloni L, Giannarini L, Sampognaro S, Parronchi P, Manetti R, Annunziato F, Livi C. Progesterone favors the development of human T helper cells producing Th2-type cytokines and promotes both IL-4 production and membrane CD30 expression in established Th1 cell clones. J Immunol. 1995;155:128–133.[Abstract]

30. Ashcroft GS, Dodsworth J, van Boxtel E, Tarnuzzer RW, Horan MA, Schultz GS, Ferguson MWJ. Estrogen accelerates cutaneous wound healing associated with an increase in TGF-ß1 levels. Nat Med. 1997;11:1209–1215.




This article has been cited by other articles:


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
D. Xing, S. Nozell, Y.-F. Chen, F. Hage, and S. Oparil
Estrogen and Mechanisms of Vascular Protection
Arterioscler. Thromb. Vasc. Biol., March 1, 2009; 29(3): 289 - 295.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
R. Marfella, C. Di Filippo, M. Portoghese, F. Ferraraccio, B. Crescenzi, M. Siniscalchi, M. Barbieri, C. Bologna, M. R. Rizzo, F. Rossi, et al.
Proteasome Activity as a Target of Hormone Replacement Therapy-Dependent Plaque Stabilization in Postmenopausal Women
Hypertension, April 1, 2008; 51(4): 1135 - 1141.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
D. Xing, W. Feng, A. P. Miller, N. M. Weathington, Y.-F. Chen, L. Novak, J. E. Blalock, and S. Oparil
Estrogen modulates TNF-{alpha}-induced inflammatory responses in rat aortic smooth muscle cells through estrogen receptor-beta activation
Am J Physiol Heart Circ Physiol, June 1, 2007; 292(6): H2607 - H2612.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
J.-M. Li, M. Iwai, T.-X. Cui, L.-J. Min, M. Tsuda, J. Iwanami, J. Suzuki, M. Mogi, and M. Horiuchi
Effect of Azelnidipine on Angiotensin II-Mediated Growth-Promoting Signaling in Vascular Smooth Muscle Cells
Mol. Pharmacol., May 1, 2005; 67(5): 1666 - 1673.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
D. Xing, A. Miller, L. Novak, R. Rocha, Y.-F. Chen, and S. Oparil
Estradiol and Progestins Differentially Modulate Leukocyte Infiltration After Vascular Injury
Circulation, January 20, 2004; 109(2): 234 - 241.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
J.-M. Li, T.-X. Cui, T. Shiuchi, H.-W. Liu, L.-J. Min, M. Okumura, T. Jinno, L. Wu, M. Iwai, and M. Horiuchi
Nicotine Enhances Angiotensin II-Induced Mitogenic Response in Vascular Smooth Muscle Cells and Fibroblasts
Arterioscler. Thromb. Vasc. Biol., January 1, 2004; 24(1): 80 - 84.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
J. Titze, R. Lang, C. Ilies, K. H. Schwind, K. A. Kirsch, P. Dietsch, F. C. Luft, and K. F. Hilgers
Osmotically inactive skin Na+ storage in rats
Am J Physiol Renal Physiol, December 1, 2003; 285(6): F1108 - F1117.
[Abstract] [Full Text]


Home page
HypertensionHome page
A. P. Miller, Y.-F. Chen, D. Xing, W. Feng, and S. Oparil
Hormone Replacement Therapy and Inflammation: Interactions in Cardiovascular Disease
Hypertension, October 1, 2003; 42(4): 657 - 663.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
F. E. Rey and P. J. Pagano
The Reactive Adventitia: Fibroblast Oxidase in Vascular Function
Arterioscler. Thromb. Vasc. Biol., December 1, 2002; 22(12): 1962 - 1971.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
R. K. Dubey, S. Oparil, B. Imthurn, and E. K. Jackson
Sex hormones and hypertension
Cardiovasc Res, February 15, 2002; 53(3): 688 - 708.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
S. Sartore, A. Chiavegato, E. Faggin, R. Franch, M. Puato, S. Ausoni, and P. Pauletto
Contribution of Adventitial Fibroblasts to Neointima Formation and Vascular Remodeling: From Innocent Bystander to Active Participant
Circ. Res., December 7, 2001; 89(12): 1111 - 1121.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
R. K. Dubey and E. K. Jackson
Genome and Hormones: Gender Differences in Physiology: Invited Review: Cardiovascular protective effects of 17{beta}-estradiol metabolites
J Appl Physiol, October 1, 2001; 91(4): 1868 - 1883.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
R. K. Dubey and E. K. Jackson
Estrogen-induced cardiorenal protection: potential cellular, biochemical, and molecular mechanisms
Am J Physiol Renal Physiol, March 1, 2001; 280(3): F365 - F388.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
V. M. Miller
Vascular Control During Pregnancy : Extending Experimental Findings to Humans
Circ. Res., September 1, 2000; 87(5): 344 - 345.
[Full Text] [PDF]


Home page
CirculationHome page
G. Li, Y.-F. Chen, S. S. Kelpke, S. Oparil, and J. A. Thompson
Estrogen Attenuates Integrin-{beta}3-Dependent Adventitial Fibroblast Migration After Inhibition of Osteopontin Production in Vascular Smooth Muscle Cells
Circulation, June 27, 2000; 101(25): 2949 - 2955.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
G. Li, S.-J. Chen, S. Oparil, Y.-F. Chen, and J. A. Thompson
Direct In Vivo Evidence Demonstrating Neointimal Migration of Adventitial Fibroblasts After Balloon Injury of Rat Carotid Arteries
Circulation, March 28, 2000; 101(12): 1362 - 1365.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
S. Oparil, S.-J. Chen, Y.-F. Chen, J. N Durand, L. Allen, and J. A Thompson
Estrogen attenuates the adventitial contribution to neointima formation in injured rat carotid arteries
Cardiovasc Res, December 1, 1999; 44(3): 608 - 614.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. J. Scheidegger, B. Cenni, D. Picard, and P. Delafontaine
Estradiol Decreases IGF-1 and IGF-1 Receptor Expression in Rat Aortic Smooth Muscle Cells. MECHANISMS FOR ITS ATHEROPROTECTIVE EFFECTS
J. Biol. Chem., December 1, 2000; 275(49): 38921 - 38928.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, G.
Right arrow Articles by Thompson, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, G.
Right arrow Articles by Thompson, J. A.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*ESTRADIOL
*TEFLON
Related Collections
Right arrow Animal models of human disease
Right arrow Smooth muscle proliferation and differentiation
Right arrow Receptor pharmacology