(Circulation. 1999;100:1639-1645.)
© 1999 American Heart Association, Inc.
Basic Science Reports |
From the University of Alabama at Birmingham, Departments of Medicine, Vascular Biology and Hypertension Program, and Surgery, Division of Transplantation; and the Ben May Institute for Cancer Research, University of Chicago (G.L.G.), Chicago, Ill.
Correspondence to John A. Thompson, PhD, 752 Lyons Harrison Research Bldg, 701 S 19th St, Birmingham, AL 35294-0007. E-mail athompson{at}ms.surgery.uab.edu
| Abstract |
|---|
|
|
|---|
Methods and ResultsPrimary cultures of vascular smooth muscle cells (VSMCs) and adventitial fibroblasts were derived from female Sprague-Dawley rats. Reverse transcriptasepolymerase chain reaction and Western blotting were used to determine that expression of the estrogen receptor (ER) was restricted to early-passage VSMCs. Migration of transduced (retrovirally mediated) fibroblasts was determined by counting the number of blue lacZ-expressing cells attached to Boyden-type chambers preconditioned under defined experimental conditions. Compared with growth medium alone, chambers treated with medium conditioned by VSMCs demonstrated a 2-fold increase in fibroblast migration, suggesting that VSMCs release soluble factor(s) competent to bind the Transwell membrane and promote fibroblast migration. In contrast, treatment of VSMCs with 17ß-estradiol (10-9 to 10-7 mol/L) before preconditioning of the chamber induced a dose-dependent inhibition of fibroblast migration. Cotreatment of VSMCs with 17ß-estradiol and the ER antagonist ICI-182780 (10-7 mol/L) blocked the inhibitory effect of estrogen on fibroblast migration.
ConclusionsThese observations suggest a novel mechanism of hormonal vasoprotection by which estrogen directly modulates VSMC expression of factor(s) controlling migration of adventitial fibroblasts via an ER-dependent mechanism.
Key Words: hormones cells muscle, smooth arteries restenosis
| Introduction |
|---|
|
|
|---|
A variety of animal models have demonstrated the inhibitory effects of estrogen on the vascular injury response. The balloon-injured rat carotid artery model has been used extensively in our own laboratory to study this issue.7 8 Early preliminary studies with this model have suggested that estrogen treatment attenuates both adventitial activation and the potential translocation of adventitial fibroblasts into medial and neointimal compartments. The present in vitro study was designed to provide insight into potential cellular and molecular mechanisms of adventitial cell migration that could be induced by endoluminal vascular injury and inhibited by estrogen. Primary cultures of adventitial fibroblasts from female rat carotid arteries were derived, characterized, and evaluated for their migratory behavior in response to conditioned medium from vascular smooth muscle cells (VSMCs) pretreated in the presence and absence of estrogen. Several lines of evidence suggest that estrogen indirectly attenuates fibroblast migration after estrogen receptor (ER)-dependent modulation of VSMC release of a soluble chemoattractant factor(s).
| Methods |
|---|
|
|
|---|
Primary adventitial fibroblasts were recovered from the carotid arteries of intact female Sprague-Dawley rats by use of a solid support consisting of nonwoven, multifilament, angel-hair fibers of expanded polytetrafluoroethylene (PTFE) prepared as described.10 11 These fibers were surgically implanted into the neck cavity of the rat, adjacent to the carotid adventitia. Two to 3 weeks after implantation, the visible PTFE sponge was surgically removed and digested with collagenase to recover resident cells.10 11 Explanted cells were seeded and expanded in culture with complete medium.
Subconfluent (70% to 80%) primary adventitial fibroblasts (passage 3 to 4) were treated with retroviral particles encoding ß-galactosidase (lacZ) as described.12 Transduced adventitial fibroblasts were isolated by fluorescence-activated cell sorter (FACS), plated, and expanded in complete medium for subsequent analyses. Expression of lacZ was monitored with the chromogenic substrate Bluo-gal.
In Situ Immunohistochemical Analysis
VSMCs and adventitial fibroblasts were seeded
(1x104 cells) onto glass coverslips and allowed
to attach (16 hours) in complete medium. Attached cells were washed in
PBS and maintained (48 hours) under normal culture conditions. Cells
were fixed (15 minutes) in 4% (vol/vol) phosphate-buffered formalin
and incubated (15 minutes) with 1% (vol/vol)
H2O2 in methanol. Fixed
cells were washed with 50 mmol/L Tris-HCl (pH 7.5) containing 0.1
mol/L NaCl and 0.05% (vol/vol) Tween 20 (TTBS) and incubated (37°C,
45 minutes) in a humidified chamber with specific monoclonal and
polyclonal antibodies (Table 1
)
diluted in TTBS according to the manufacturers' recommendations
(Boehringer Mannheim, Serotec, Dako, Novacastra Laboratories,
Sigma, Calbiochem, ICN). Antibody binding was detected with a Quick
Staining Kit (Dako) using either swine anti-rabbit or swine
anti-mouse horseradish peroxidase (HRP)conjugated secondary
antibodies. Peroxidase-stained samples were developed with 0.5 mg/mL
3,3'-diaminobenzidine and counterstained with Mayer's hematoxylin
(Sigma). Chromogenic development of stained samples
permitted analysis of positive brown staining by light
microscopy. Four coverslips per antibody staining of individual cell
populations were analyzed, and
5 fields (
250 cells) per
coverslip were counted.
|
Measurement of NADPH and NADH Oxidase Activity
Confluent VSMCs and adventitial fibroblasts were washed in PBS
and pretreated (4 hours) with serum-free DMEM in the absence or
presence of 10-7 mol/L angiotensin
II. Treated cells were washed (PBS), scrape-harvested in 15 mL ice-cold
PBS, and centrifuged (10 minutes, 4°C) at 1500 rpm. Pelleted
cells were resuspended and prepared by Dounce
homogenization in 1.0 mL lysis buffer (4°C)
containing protease inhibitors (20 mmol/L potassium
phosphate [pH 7.0], 1 mmol/L EGTA, 10 µg/mL aprotinin, 0.5
µg/mL leupeptin, 0.7 µg/mL pepstatin, and 0.5 mmol/L
phenylmethylsulfonyl fluoride). Protein concentration was
determined by the Bradford assay (Pierce). NADPH and NADH oxidase
activities were measured by a modified luminescence
assay13 in 50 mmol/L phosphate buffer (pH 7.0)
containing 1 mmol/L EGTA, 150 mmol/L sucrose, 100
µmol/L of either NADPH or NADH, and cellular homogenate
(20 to 40 µg total protein). The reaction was initiated by the
addition of 150 µL of lucigenin (final concentration 500
µmol/L). Photon emission from reduced lucigenin was measured every 15
seconds with a 5-second delay in a luminometer (model Optocomp I).
NADPH and NADH oxidase activities were expressed by relative light
units and normalized to protein content of each sample run in
quadruplicate.
Nucleic Acid Extraction and Analysis
Total RNA was analyzed by reverse
transcriptasepolymerase chain reaction (RT-PCR) techniques under
previously established conditions.12 Synthetic DNA
amplimers specific for rat ER-
were sense, AATTCTGACAATCGACGCCAG and
antisense, GTGCTTCAACATTCTCCCTCCTC. Synthetic DNA amplimers specific
for rat GAPDH were sense, TGAAGGTCGGTGTGAACGGATTTGGC and antisense,
CATGTAGGCCATGAGGTCCACCAC. RT-PCR products were analyzed by
2% (wt/vol) agarose gel electrophoresis. After electrophoresis,
amplification products were stained with ethidium bromide,
visualized with UV light, and standardized to levels of amplified GAPDH
mRNA.12
Protein Extraction and Western Analysis
Whole-cell extracts of rat VSMCs, adventitial fibroblasts, and
human breast cancer cells (MCF-7) were prepared by releasing cells from
monolayer cultures with 2x SDS gel sample buffer (4% wt/vol SDS, 12%
wt/vol sucrose, 10% vol/vol ß-mercaptoethanol, 0.125 mol/L Tris [pH
6.8], and 0.05% wt/vol bromophenol blue). All samples were sonicated
for 1 second and heated at 90°C for 5 minutes before electrophoresis.
Proteins were fractionated under reducing conditions by routine 10%
(wt/vol) SDS-PAGE. Resolved proteins were transferred
electrophoretically to nitrocellulose membranes (Amersham), which were
probed (1 hour) with purified ER-21 (0.5 µg/mL) in the presence or
absence of a 50-fold molar excess of a synthetic
HER121 peptide14 and followed by
HRPconjugated goat anti-rabbit IgG (1:2000 dilution, Sigma).
Immunoreactive bands were visualized by treatment with ECL Western
blotting detection reagents (Amersham) according to the manufacturer's
instructions.
Cell Migration
VSMCs (8x104 cells/well) were seeded in
24-well plates (Costar) in complete medium and grown to 70% to 80%
confluence (Figure 1A
). Subconfluent
VSMCs were washed in PBS, fed DMEM containing 5% (vol/vol) FBS, and
maintained for 24 hours (Figure 1B
). Where experimentally
indicated, the medium contained 17ß-estradiol
(10-9 to 10-7 mol/L) or
vehicle (0.01% ethanol). To determine an ER-dependent effect, VSMCs
were pretreated (4 hours) with the estrogen antagonist
ICI-182780 (10-7 to 10-5
mol/L) or vehicle (0.01% ethanol) before 17ß-estradiol exposure.
VSMC-conditioned medium was added to a new well and incubated (16
hours) with a Transwell insert (8-µm pores) that had been
precoated (16 hours) with 0.1% (wt/vol) gelatin (Figure 1C
).
The conditioned Transwell chamber was moved to a separate well
containing 0.7 mL DMEM supplemented with 0.1% (wt/vol) BSA (Figure 1D
).
|
Transduced adventitial fibroblasts were grown to 70% to 80%
confluence in complete medium, washed (PBS) twice, detached with 0.1%
(wt/vol) trypsin, and resuspended (1.5x105
cells/mL) in DMEM supplemented with 0.1% (wt/vol) BSA. A suspension
(0.2 mL) of transduced fibroblasts was pipetted into the conditioned
Transwell chamber and incubated (4 hours) at 37°C (Figure 1D
). After incubation (Figure 1E
), nonmigratory
fibroblasts were removed carefully from the upper face of the
Transwell chambers with a cotton swab. Transwell membranes were
fixed in 0.2% (vol/vol) glutaraldehyde and stained
with the chromogenic substrate Bluo-gal. LacZ-expressing
(blue) fibroblasts that had migrated and adhered to the Transwell
membrane were microscopically counted. In all cases, 4 separate
high-power fields were counted per membrane, and all experiments were
run in duplicate.
Cell Adhesion
VSMCs and adventitial fibroblasts were seeded in 24-well plates
in complete medium and grown to 70% to 80% confluence. Subconfluent
cells were washed (PBS), fed DMEM containing either 5% (vol/vol) or
0.5% (vol/vol) FBS in the presence or absence of
10-8 mol/L 17ß-estradiol, and maintained (24
hours) at 37°C. Media conditioned by individual cell populations
under defined experimental conditions (n=5/condition) were collected
separately. Aliquots (100 µL/well) of conditioned medium were added
to individual wells of 96-well cluster plates and incubated (16 hours)
at 4°C. Each treated well was washed gently with adhesion assay
buffer (140 mmol/L NaCl, 5.4 mmol/L KCl, 1 mmol/L
CaCl2, 1 mmol/L MgCl2,
0.5 mmol/L MnCl2, 5.56 mmol/L
D-glucose, 10 mmol/L HEPES [pH 7.4], and 1% wt/vol
BSA), and nonspecific binding sites were blocked (1 hour, 37°C) with
1% (wt/vol) BSA.
VSMCs and adventitial fibroblasts were grown to 70% to 80% confluence in complete medium, washed, detached with 0.1% (wt/vol) trypsin, and resuspended (4x105 cells/mL) in adhesion assay buffer. A suspension (0.1 mL) of cells was pipetted into individual wells previously treated with conditioned medium and incubated (45 minutes; 37°C). Nonadherent cells were removed by washing (PBS) and swabbing of the sides of the well. Adherent cells were fixed with 4% (vol/vol) paraformaldehyde and stained with 1% (wt/vol) crystal violet, followed by air-drying and extraction with 10% (vol/vol) acetic acid. Dye uptake was quantified by an ELISA plate reader, and results were determined as the mean total absorbance at 570 nm.
Statistical Analysis
Within each in vitro experiment, cells were matched for lineage,
population doublings, and days before or after confluence to avoid
differences related to cell culture variables. Statistical
analyses were carried out with the Crunch statistical package
on an IBM-compatible personal computer. Our primary statistical test
was multivariate ANOVA. Differences in mean values due
to main effects and their interactions were tested, with a value of
P<0.05 considered statistically
significant.15
| Results |
|---|
|
|
|---|
Microscopic examination was used to compare morphological appearances
of expanded populations of VSMCs and adventitial fibroblasts derived
from their respective explants. Primary VSMCs displayed a typical
monolayer phenotype exhibiting a characteristic hill-and-valley
growth pattern. In contrast, stromal fibroblasts displayed a
spindle-like, bipolar and tripolar morphology exhibiting small
processes at each pole and a smooth cell border. Compared with primary
VSMCs (doubling time=27.7 hours), primary adventitial fibroblasts
(doubling time=19.4 hours) exhibited a growth advantage under normal
culture conditions. In situ immunohistochemical analysis (Table 1
) of both primary cell populations failed to demonstrate the
appearance of cells with either endothelial (vWF,
QBEnd/40, UEA-1), lymphatic (MAC-1, ED-1, CD5), epithelial (NCL-EMA,
cytokeratin), or mesothelial (HBME-1) markers. Instead, expanded
populations of both VSMCs and adventitial cells demonstrated positive
staining for markers (vimentin,
-SM actin, actin, HHF35, myosin)
typically found in smooth muscle cells but often shared with
fibroblasts. After expansion in culture, activated adventitial
fibroblasts failed to demonstrate expression of desmin, an observation
consistent with previous efforts.6
Both VSMCs and adventitial fibroblasts exhibited NADH and NADPH oxidase
activities, each of which was stimulated (>1.4-fold) after treatment
with angiotensin II (Table 2
). Compared with NADPH oxidase activity,
both VSMCs (>7-fold) and adventitial fibroblasts (>9-fold)
demonstrated significantly higher levels of NADH oxidase activity.
However, compared with VSMCs, adventitial fibroblasts
consistently demonstrated significantly higher levels of both
NADPH (>2-fold) and NADH (>2.5-fold) oxidase activity. Collectively,
these results are consistent with previous
studies.13 16 17
|
To rigorously track the migratory behavior of adventitial fibroblasts,
primary cells were transduced, selected by 2 rounds of FACS, and
expanded for biochemical analyses. This approach routinely
resulted in an adventitial fibroblast preparation in which >95% of
the cells expressed readily detectable levels of lacZ. Compared with
primary adventitial fibroblasts, transduced cells exhibited a similar
phenotype, growth behavior, expression of characteristic
markers (Table 2
), and high angiotensin
IIinducible levels of NADPH/NADH oxidase. At least 4 separate explant
preparations of primary and transduced fibroblast populations were
examined, and each provided consistent results.
A characteristic RT-PCR product (344 bp) was identified for the
ER-
gene in early passages (from 3 to 6) of VSMCs (Figure 2
). Late passages (from 13 to 18) of
VSMCs lost their ability to express ER-
mRNA. Early-passage
nontransduced and transduced adventitial fibroblasts both failed to
demonstrate detectable expression of ER-
mRNA (Figure 2
).
Early passages of VSMCs expressed readily detectable cellular levels of
immunoreactive ER-
protein with an apparent molecular mass of
65
kDa (Figure 3
). In contrast, transduced
adventitial fibroblasts failed to express ER-
protein. Western
analysis of late-passage VSMCs and nontransduced adventitial
fibroblasts failed to demonstrate the appearance of immunoreactive
ER-
protein (data not shown). Collectively, these results are
consistent with RT-PCR analyses and confirm that
expression of ER-
mRNA and protein is restricted to early passages
of primary rat VSMCs.
|
|
Transduced, lacZ-expressing fibroblasts demonstrated minimal migration
to Transwell membranes preconditioned with serum-free medium
(Figure 4A
). Preconditioning of the
membrane with complete medium increased the number of migrating
transduced fibroblasts. Treatment of the Transwell membrane with
medium conditioned by VSMCs induced a statistically significant
(P<0.01), nearly 2-fold increase in the number of migrating
fibroblasts. Treatment of VSMCs with 17ß-estradiol inhibited
adventitial fibroblast migration in a dose-dependent manner over the
range of 10-9 to 10-7
mol/L. Addition of 17ß-estradiol (10-7 mol/L)
to medium conditioned by late-passage VSMCs had no effect on
adventitial fibroblast migration. Furthermore, there was no evidence of
lacZ-expressing cells either in the culture medium of the lower chamber
or attached to the bottom of the lower chamber.
|
The inclusion of the selective ER antagonist ICI-182780
(10-6 mol/L) alone in medium conditioned by
VSMCs had no effect on fibroblast migration (Figure 4B
).
However, pretreatment of VSMCs with the ER antagonist
produced a dose-dependent inhibition of the estradiol effect, such that
a 100-fold molar excess completely abrogated the ability of
10-8 mol/L 17ß-estradiol to attenuate
VSMC-induced migration of adventitial fibroblasts. 17ß-Estradiol
(10-7 to 10-9 mol/L)
pretreatment of ER-negative adventitial fibroblasts had no effect on
their migration (Figure 5
). In addition,
medium conditioned by primary adventitial fibroblasts, treated in the
presence or absence of 10-8 mol/L
17ß-estradiol, had no effect on fibroblast migration (Figure 5B
).
|
The migration assay alone does not determine whether the ER-dependent
estrogen effect is on chemotaxis or attachment or both. Consequently,
we investigated primary cell adhesion to medium conditioned by either
VSMCs or adventitial fibroblasts in the absence or presence of
10-8 mol/L 17ß-estradiol (Figure 6
). Compared with preconditioning with
serum-free medium, treatment of plates with medium conditioned by VSMCs
induced a significant increase in the number of adhering fibroblasts
(Figure 6A
) or VSMCs (Figure 6B
). Likewise, treatment of
plates with medium conditioned by adventitial fibroblasts induced a
significant increase in the number of adhering fibroblasts or VSMCs.
Inclusion of 10-8 mol/L 17ß-estradiol during
medium preconditioning had no significant effect on either fibroblast
or VSMC adhesion regardless of the cellular source of attachment
factors.
|
| Discussion |
|---|
|
|
|---|
Evidence that fibroblasts can serve as targets for chemoattractant/growth factors comes mainly from studies of wound healing.18 19 20 21 The wound-healing process is associated with early activation of fibroblasts, which subsequently proliferate, migrate, and differentiate into myofibroblasts. Similar cellular responses have been described in a variety of other pathological conditions associated with fibrogenesis and organ remodeling.21 22 23 24 Accordingly, it has been hypothesized that this fibroblast response is a general feature of tissue repair and therefore may also occur during vascular injury.21 The observation that "nonmuscle" cells are found in the media of large arteries and veins of the dog and have a higher proliferative capacity than VSMCs25 has questioned the traditional belief that undifferentiated VSMCs are entirely responsible for neointima formation in injured blood vessels.26
Systemic estrogen influences the development of intraperitoneal scarring by suppressing connective tissue formation in a murine model of peritoneal adhesion formation.27 In contrast, postmenopausal hormone replacement therapy increases the dermal content of collagen and limits age-related increases in skin extensibility.28 In vitro studies have shown that estrogen influences processes critical to wound repair, such as cellular proliferation and cytokine production.29 30 Furthermore, there is evidence that the estrogen effect on wound healing may be mediated by the action of estrogen-stimulated cytokine release.30 These studies suggested that estrogen provided an indirect effect on dermal fibroblasts by stimulating responses in other cell types invading the wound site. In studies reported here, a similar indirect effect of estrogen is suggested by which ER-dependent modulation of VSMC release of a soluble factor(s) attenuates adventitial fibroblast migration. Additional in vitro and in vivo efforts will be necessary to identify the soluble factor(s) involved in this hormone-mediated vasoprotective process.
| Acknowledgments |
|---|
Received January 27, 1999; revision received May 27, 1999; accepted June 2, 1999.
| References |
|---|
|
|
|---|
2.
Kohchi K, Takebayashi S, Hiroki T, Nobuyoshi M.
Significance of adventitial inflammation of the coronary artery
in patients with unstable angina: results at autopsy.
Circulation. 1985;71:709716.
3. Prescott MF, McBride CK, Court M. Development of intimal lesions after leukocyte migration into the vascular wall. Am J Pathol. 1989;135:835846.[Abstract]
4. Beesley JE, Honey AC, Martin JF. Ultrastructural assessment of lesion development in the collared rabbit carotid artery model. Cells Mater. 1992;2:201208.
5.
Shi Y, Pieniek M, Fard A, O'Brien JE, Mannion JD,
Zalewski A. Adventitial remodeling following coronary
arterial injury. Circulation. 1996;93:340348.
6.
Shi Y, O'Brien JE, Fard A, Mannion JD, Wang D,
Zalewski A. Adventitial myofibroblasts contribute to
neointimal formation in injured porcine coronary
arteries. Circulation. 1996;94:16551664.
7.
Chen SJ, Li H, Durand J, Oparil S, Chen YF. Estrogen
reduces myointimal proliferation after balloon injury of rat carotid
artery. Circulation. 1996;93:577584.
8.
Oparil S, Levine RL, Chen SJ, Durand J, Chen YF.
Sexually dimorphic response of the balloon-injured rat carotid artery
to hormone treatment. Circulation. 1997;95:13011307.
9.
Ross R. Growth of smooth muscle cell in culture and
formation of elastic fibers. J Cell Biol. 1971;50:172186.
10.
Thompson JA, Haudenschild CC, Anderson KD, DiPietro JM,
Anderson WF, Maciag T. Heparin-binding growth factor 1 induces the
formation of organoid neovascular structures in vivo. Proc Natl
Acad Sci U S A. 1989;86:79287932.
11.
Thompson JA, Anderson KD, DiPietro JM, Zwiebel JA,
Zametta M, Anderson WF, Maciag T. Site-directed neovessel formation in
vivo. Science. 1988;241:13491352.
12. Opalenik SR, Shin JT, Wehby JN, Mahesh VK, Thompson JA. The HIV-1 TAT protein induces the expression and extracellular appearance of acidic fibroblast growth factor. J Biol Chem. 1995;270:17451746.
13.
Griendling KK, Minieri CA, Ollerenshaw JD, Alexander
RW. Angiotensin II stimulates NADH and NADPH oxidase
activity in cultured vascular smooth muscle cells. Circ Res. 1994;74:11411148.
14.
Hess RA, Gist DH, Bunick D, Lubahn DB, Farrell A, Bahr
J, Cooke PS, Greene GL. Estrogen receptor (
and ß) expression
in the excurrent ducts of the adult male rat reproductive tract.
J Androl. 1997;18:602611.
15. Milliken GA, Johnson DE, eds. Analysis of Messy Data: Design Experiments (Vol 1). New York, NY: Van Nostrand Reinhold, 1984.
16.
Pagano PJ, Chanock SJ, Siwik DA, Colucci WS, Clark JK.
Angiotensin II induces p67phox mRNA
expression and NADPH oxidase superoxide generation in rabbit aortic
adventitial fibroblasts. Hypertension. 1998;32:331337.
17.
Pagano PJ, Clark JK, Cifuentes-Pagano ME, Clark SM,
Callis M, Quinn MT. Localization of a constitutively active,
phagocyte-like NADPH oxidase in rabbit aortic adventitia: enhancement
by angiotensin II. Proc Natl Acad Sci U S A. 1997;94:1448314488.
18. Gabbiani G, Ryan GB, Majno G. Presence of modified fibroblasts in granulation tissue and their possible role in wound contraction. Experientia. 1971;27:549550.[Medline] [Order article via Infotrieve]
19.
Darby I, Skalli O, Gabbiani G.
-Smooth muscle
actin is transiently expressed by myofibroblasts during experimental
wound healing. Lab Invest. 1990;63:2129.[Medline]
[Order article via Infotrieve]
20.
Zalewski A, Shi Y. Vascular myofibroblasts: lessons
from coronary repair and remodeling. Arterioscler Thromb
Vasc Biol. 1997;17:417422.
21. Kapanci Y, Burgan S, Pietra GG, Conne B, Gabbiani G. Modulation of actin isoform expression in alveolar myofibroblasts (contractile interstitial cells) during pulmonary hypertension. Am J Pathol. 1990;136:881889.[Abstract]
22.
Johnson RJ, Lida H, Alpers CE, Majesky MW,
Schwartz SM, Pritzi P, Gordon K, Gown AM. Expression of smooth muscle
cell phenotype by rat mesangial cells in immune
complex nephritis:
-smooth muscle actin is a marker of
mesangial cell proliferation. J Clin
Invest. 1991;87:847858.
23.
Willems IEMG, Hevenith MH, De Mey JGR, Daemen MJAP.
The
-smooth muscle cells in healing human myocardial scars.
Am J Pathol. 1994;145:868875.[Abstract]
24. Holifield B, Helgason T, Jemelka S, Taylor A, Navran S, Allen J, Seidel C. Differentiated vascular myocytes: are they involved in neointimal formation? J Clin Invest. 1996;97:814825.[Medline] [Order article via Infotrieve]
25. Schwartz SM, Reidy MA, Clowes AW. Kinetics of atherosclerosis: a stem cell model. Ann N Y Acad Sci. 1985;454:292294.[Medline] [Order article via Infotrieve]
26. Frazier-Jensen MR, Mott FJ, Witte PL, Kovacs EJ. Estrogen suppression of connective tissue deposition in a murine model of peritoneal adhesion formation. J Immunol. 1996;156:30363042.[Abstract]
27. Pierard GE, Letawe C, Dowlati A, Pierard-Franchimont C. Effect of hormone replacement therapy for menopause on the mechanical properties of the skin. J Am Geriatr Soc. 1995;43:662665.[Medline] [Order article via Infotrieve]
28.
Oursler MJ, Cortese C, Keeting P, Anderson MA, Bonde
SK, Riggs BL, Spelsberg TC. Modulation of transforming growth
factor-beta production in normal human osteoblast-like cells by
17 beta-estradiol and parathyroid hormone. Endocrinology. 1991;129:33133320.
29. Piccinni MP, Giudizi MG, Biagiotti R, Beloni L, Giannarini L, Sampognaro S, Parronchi P, Manetti R, Annunziato F, Livi C. Progesterone favors the development of human T helper cells producing Th2-type cytokines and promotes both IL-4 production and membrane CD30 expression in established Th1 cell clones. J Immunol. 1995;155:128133.[Abstract]
30. Ashcroft GS, Dodsworth J, van Boxtel E, Tarnuzzer RW, Horan MA, Schultz GS, Ferguson MWJ. Estrogen accelerates cutaneous wound healing associated with an increase in TGF-ß1 levels. Nat Med. 1997;11:12091215.
This article has been cited by other articles:
![]() |
D. Xing, S. Nozell, Y.-F. Chen, F. Hage, and S. Oparil Estrogen and Mechanisms of Vascular Protection Arterioscler. Thromb. Vasc. Biol., March 1, 2009; 29(3): 289 - 295. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Marfella, C. Di Filippo, M. Portoghese, F. Ferraraccio, B. Crescenzi, M. Siniscalchi, M. Barbieri, C. Bologna, M. R. Rizzo, F. Rossi, et al. Proteasome Activity as a Target of Hormone Replacement Therapy-Dependent Plaque Stabilization in Postmenopausal Women Hypertension, April 1, 2008; 51(4): 1135 - 1141. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Xing, W. Feng, A. P. Miller, N. M. Weathington, Y.-F. Chen, L. Novak, J. E. Blalock, and S. Oparil Estrogen modulates TNF-{alpha}-induced inflammatory responses in rat aortic smooth muscle cells through estrogen receptor-beta activation Am J Physiol Heart Circ Physiol, June 1, 2007; 292(6): H2607 - H2612. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-M. Li, M. Iwai, T.-X. Cui, L.-J. Min, M. Tsuda, J. Iwanami, J. Suzuki, M. Mogi, and M. Horiuchi Effect of Azelnidipine on Angiotensin II-Mediated Growth-Promoting Signaling in Vascular Smooth Muscle Cells Mol. Pharmacol., May 1, 2005; 67(5): 1666 - 1673. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Xing, A. Miller, L. Novak, R. Rocha, Y.-F. Chen, and S. Oparil Estradiol and Progestins Differentially Modulate Leukocyte Infiltration After Vascular Injury Circulation, January 20, 2004; 109(2): 234 - 241. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-M. Li, T.-X. Cui, T. Shiuchi, H.-W. Liu, L.-J. Min, M. Okumura, T. Jinno, L. Wu, M. Iwai, and M. Horiuchi Nicotine Enhances Angiotensin II-Induced Mitogenic Response in Vascular Smooth Muscle Cells and Fibroblasts Arterioscler. Thromb. Vasc. Biol., January 1, 2004; 24(1): 80 - 84. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Titze, R. Lang, C. Ilies, K. H. Schwind, K. A. Kirsch, P. Dietsch, F. C. Luft, and K. F. Hilgers Osmotically inactive skin Na+ storage in rats Am J Physiol Renal Physiol, December 1, 2003; 285(6): F1108 - F1117. [Abstract] [Full Text] |
||||
![]() |
A. P. Miller, Y.-F. Chen, D. Xing, W. Feng, and S. Oparil Hormone Replacement Therapy and Inflammation: Interactions in Cardiovascular Disease Hypertension, October 1, 2003; 42(4): 657 - 663. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. E. Rey and P. J. Pagano The Reactive Adventitia: Fibroblast Oxidase in Vascular Function Arterioscler. Thromb. Vasc. Biol., December 1, 2002; 22(12): 1962 - 1971. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. K. Dubey, S. Oparil, B. Imthurn, and E. K. Jackson Sex hormones and hypertension Cardiovasc Res, February 15, 2002; 53(3): 688 - 708. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sartore, A. Chiavegato, E. Faggin, R. Franch, M. Puato, S. Ausoni, and P. Pauletto Contribution of Adventitial Fibroblasts to Neointima Formation and Vascular Remodeling: From Innocent Bystander to Active Participant Circ. Res., December 7, 2001; 89(12): 1111 - 1121. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. K. Dubey and E. K. Jackson Genome and Hormones: Gender Differences in Physiology: Invited Review: Cardiovascular protective effects of 17{beta}-estradiol metabolites J Appl Physiol, October 1, 2001; 91(4): 1868 - 1883. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. K. Dubey and E. K. Jackson Estrogen-induced cardiorenal protection: potential cellular, biochemical, and molecular mechanisms Am J Physiol Renal Physiol, March 1, 2001; 280(3): F365 - F388. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. M. Miller Vascular Control During Pregnancy : Extending Experimental Findings to Humans Circ. Res., September 1, 2000; 87(5): 344 - 345. [Full Text] [PDF] |
||||
![]() |
G. Li, Y.-F. Chen, S. S. Kelpke, S. Oparil, and J. A. Thompson Estrogen Attenuates Integrin-{beta}3-Dependent Adventitial Fibroblast Migration After Inhibition of Osteopontin Production in Vascular Smooth Muscle Cells Circulation, June 27, 2000; 101(25): 2949 - 2955. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Li, S.-J. Chen, S. Oparil, Y.-F. Chen, and J. A. Thompson Direct In Vivo Evidence Demonstrating Neointimal Migration of Adventitial Fibroblasts After Balloon Injury of Rat Carotid Arteries Circulation, March 28, 2000; 101(12): 1362 - 1365. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Oparil, S.-J. Chen, Y.-F. Chen, J. N Durand, L. Allen, and J. A Thompson Estrogen attenuates the adventitial contribution to neointima formation in injured rat carotid arteries Cardiovasc Res, December 1, 1999; 44(3): 608 - 614. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Scheidegger, B. Cenni, D. Picard, and P. Delafontaine Estradiol Decreases IGF-1 and IGF-1 Receptor Expression in Rat Aortic Smooth Muscle Cells. MECHANISMS FOR ITS ATHEROPROTECTIVE EFFECTS J. Biol. Chem., December 1, 2000; 275(49): 38921 - 38928. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1999 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |