| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
© American Heart Association, Inc.
Basic Science Reports |
From the Cardiovascular Division (T.T., P.C.S., B.L., R.T.L.) and Center for Neurological Diseases (R.M.F., S.S.S., S.R.G.), Department of Medicine, Brigham and Womens Hospital, Harvard Medical School, Boston, Mass.
Correspondence to Richard T. Lee, MD, Partners Research Facility, 65 Landsdowne St, Cambridge, MA 02139. E-mail rlee{at}rics.bwh.harvard.edu
| Abstract |
|---|
|
|
|---|
Methods and Results We evaluated a chemical library for its potential to induce cardiac differentiation of ES cells in the absence of embryoid body formation. Using ES cells stably transfected with cardiac-specific
-cardiac myosin heavy chain (MHC) promoter-driven enhanced green fluorescent protein (EGFP), 880 compounds approved for human use were screened for their ability to induce cardiac differentiation. Treatment with ascorbic acid, also known as vitamin C, markedly increased the number of EGFP-positive cells, which displayed spontaneous and rhythmic contractile activity and stained positively for sarcomeric myosin and
-actinin. Furthermore, ascorbic acid induced the expression of cardiac genes, including GATA4,
-MHC, and ß-MHC in untransfected ES cells in a developmentally controlled manner. This effect of ascorbic acid on cardiac differentiation was not mimicked by the other antioxidants such as N-acetylcysteine, Tiron, or vitamin E.
Conclusions Ascorbic acid induces cardiac differentiation in ES cells. This study demonstrates the potential for chemically modifying the cardiac differentiation program of ES cells.
Key Words: stem cells ascorbic acid myocytes
| Introduction |
|---|
|
|
|---|
Recent advances in biotechnology such as high-throughput screening enable systematic evaluation of large chemical libraries for their biological activities. Compound screening has traditionally been used to approach specific drug targets, but this methodology can also be utilized to study poorly understood biological processes, and the broad diversity of a chemical library can be exploited to identify unique molecular pathways.4
Here we report the results of screening a broad range of compounds to identify agents enhancing cardiac differentiation of ES cells. We screened 880 compounds approved for human use by using ES cells stably transfected with cardiac muscle specific
-myosin heavy chain (MHC) promoter-driven enhanced green fluorescent protein (EGFP) as a reporter. Treatment of ES cells with ascorbic acid markedly increased the rate of differentiation into beating cardiac myocytes without forming embryoid bodies (EBs). This result suggests a novel role of ascorbic acid in cardiac myocyte differentiation and presents a simple and effective strategy for enhancing spontaneous differentiation of ES cells into cardiac myocytes.
| Methods |
|---|
|
|
|---|
Plasmid Construction and Stable Transfection
The 5.5 k bp fragment of the
MHC promoter,6 kindly provided by Jeffrey Robbins (Childrens Hospital Research Foundation, Cincinnati, Ohio), was subcloned into the SacI/SalI sites of pEGFP-1 (Clontech). After linearization, the plasmid was transfected into CGR8 ES cells with Fugene6 (Roche). The transfected ES cells were selected for 10 days using 200 µg/mL G418, and neomycin-resistant clones showing bright fluorescence matching beating areas were further selected.
Compound Library and Screening
The compound library named "The FDA2000 Drug Library"4 was used for screening. From the database containing information on US Food and Drug Administration-approved drugs, including drug indications, contraindications, chemical formulae, and mechanism of action, approximately 15 000 drugs were identified on the market, and 1345 were recognized as unique chemical entities. This library contains a drug repository of 880 of these bioactive compounds approved for human use.4 For screening, ES cells seeded at a density of 2000 cells/well in 96 well plates were treated with compounds at a final concentration of 10-5 mol/L, and the medium containing chemicals was changed every second day. The expression of EGFP was assessed with daily microscopic observation.
Preparation of Single Cells
For the experiments using single cells, cells were dissected and isolated by enzymatic dispersion using 0.8 mg/mL collagenase type 2 (Worthington Biochemical Corporation) in Hanks Balanced Salt Solution. The dissociated cells were plated onto fibronectin-coated glass coverslips or used for flow cytometry analysis.
Immunohistochemical Staining
Cells were stained with the primary antibody against sarcomeric myosin, MF20 (Developmental Studies Hybridoma Bank), or
-actinin, EA-53 (Sigma), with Alexa Fluor 568-conjugated anti-mouse IgG antibody (Molecular Probes) as a secondary antibody. Nuclear staining was performed with Hoechst 33342.
Quantitative Reverse Transcription-Polymerase Chain Reaction
Total RNA was extracted from ES cells and analyzed by kinetic real time-polymerase chain reaction (PCR) using the Light Cycler system (Roche) with RNA Master SYBRGreen I Kit for relative quantification of
-MHC, ß-MHC, and GATA4. The transcript for ß-tubulin was used for internal normalization.
Semiquantitative Reverse Transcription-PCR
Semiquantitative reverse transcription (RT)-PCR for GATA4, Nkx2.5,
-MHC, ß-MHC, atrial natriuretic factor (ANF), Tie-2, and ß-tubulin was performed using standard procedures. First strand cDNA was synthesized, serially diluted 1:2, and analyzed.
Primers used were (5' to 3') GATA4: CTCGATATGTTTGATGACTTCT (forward), CGTTTTCTGGTTTGAATCCC (reverse); Nkx2.5: AGCAACTTCGTGAACTTTG (forward), CCGGTCCTAGTGTGGA (reverse);
-MHC: ACCGTGGACTACAACAT (forward), CTTTCGCTCGTTGGGA (reverse); ß-MHC: ACCCCTACGATTATGCG (forward), GTGACGTACTCGTTGCC (reverse); ANF: GGGGGTAGGATTGACAGGAT (forward), CAGAGTGGGAGAGGCAAGAC (reverse); Tie-2: TCTGGGTGGCCACTACCTAC (forward), CATCCCCAAAGTAAGGCTCA (reverse); and ß-tubulin: CTGGGCTAAAGGCCAC (forward), AGACACTTTGGGCGAG (reverse).
Immunoblot Analysis
The cells were lysed in modified radioimmunoprecipitation buffer containing protease and phosphatase inhibitors, and the protein concentration in the supernatant was determined using a Bio-Rad protein assay. Samples were subjected to 7.5% SDS-polyacrylamide gel electrophoresis, and the separated proteins were electrophoretically transferred to polyvinylidene difluoride membranes (Perkin Elmer Life Sciences). Blots were incubated with the primary antibody against sarcomeric myosin, MF20, or
-actinin, EA-53, and the primary antibodies were detected using horseradish peroxidase-labeled donkey anti-mouse immunoglobulin G, followed by enhanced chemiluminescence (Perkin Elmer Life Sciences).
Statistical Analysis
All experiments were performed at least 3 times, and data were expressed as mean±standard deviation and analyzed by Students t test or 1-way ANOVA with post hoc analysis. A value of P<0.05 was considered statistically significant.
| Results |
|---|
|
|
|---|
-MHC is among cardiac-specific genes detectable early in the developing heart in vivo and is specific for cardiac myocytes in differentiating ES cells,1,6,7 the
-MHC promoter was chosen to drive EGFP expression. When differentiation was induced through the hanging drop method of EB formation, spontaneously contracting cell clusters developed within EB outgrowths at 7 days (attached culture for 2 days after 5 days hanging drop suspension culture). During all stages of differentiation, strong green fluorescence was exclusively detected in these beating areas, whereas fluorescence was undetectable in undifferentiated ES cells (data not shown). EGFP expression was strongly correlated with staining against sarcomeric myosin or
-actinin (data not shown).
In vitro ES cell differentiation usually requires the formation of EB cell aggregates, a process suboptimal for high-throughput screening. In this study, we used monolayer cultures of ES cells without EB formation to reduce background differentiation and enable high-throughput screening. Undifferentiated ES cells were seeded in 96 well plates at a density of 2000 cells/well and treated with compounds at a final concentration of 10-5 mol/L. Differentiation of cells into cardiac myocytes was monitored by daily fluorescent microscopic observation. The only compound found to reproducibly induce differentiation was ascorbic acid (Figure 1). After cells were treated with various concentrations of ascorbic acid for 12 days, fluorescent microscopic analysis revealed that ascorbic acid significantly increased the number of cells expressing EGFP (Figure 1A). When cells were dissociated and the numbers of EGFP-positive and total cells were counted, ascorbic acid increased the proportion of EGFP-positive cells in a dose-dependent manner (Figure 1B), which was confirmed by flow cytometry analysis (data not shown). Although the background rate of EGFP-expressing cells varied, ascorbic acid reproducibly increased the number of EGFP-positive cells. The effect of ascorbic acid to induce cardiac differentiation was validated in 2 independent stably transfected clones, showing that the effect of ascorbic acid was not specific to a particular stably transfected clone. Because extracellular pH may influence cellular functions such as proliferation and differentiation,8,9 HEPES-buffered medium was used in some experiments to abolish the change in pH by addition of ascorbic acid. No difference in ES cell differentiation was noted between the medium with or without HEPES buffer (data not shown), indicating that the change in pH is not involved in the effect of ascorbic acid on cardiac differentiation. EGFP-positive cells formed foci where cells exhibited spontaneous and rhythmic contractile activity, with adjacent cells beating synchronously. Furthermore, these EGFP-expressing and contracting cells stained positively with antibody against sarcomeric myosin or
-actinin, and Hoechst nuclear staining demonstrated a very high cellular density (Figure 2A). When cells were dissociated and plated at a density sufficient for analysis of individual cells, high power views of sarcomeric
-actinin staining revealed developed myofibrillar structure in these EGFP-positive cells (Figure 2B). These results indicate that ascorbic acid markedly increases the proportion of EGFP-positive cells, which were cardiac myocytes.
|
|
Expression of Cardiac Specific Genes Induced by Ascorbic Acid
The effect of ascorbic acid on the expression of cardiac marker genes was examined by semiquantitative and kinetic real time-PCR in untransfected, naïve CGR8 ES cells. Semiquantitative RT-PCR demonstrated that all cardiac markers tested, such as GATA4, Nkx2.5,
-MHC, ß-MHC, and ANF, were increased by ascorbic acid, whereas the expression of Tie-2, which is expressed almost exclusively in endothelial cells, was not altered by ascorbic acid (Figure 3A). These results suggest that ascorbic acid specifically induces cardiac differentiation of ES cells. Furthermore, time course analysis with kinetic PCR revealed that ascorbic acid increased expression of GATA4,
-MHC, and ß-MHC in a time-dependent manner (Figure 3B). Ascorbic acid-induced GATA4 expression was detected as early as day 4, whereas the induction of MHCs expression was observed at day 8. Both
-MHC and ß-MHC expression reached maximal levels at day 10. Thereafter, the level of ß-MHC expression declined, whereas
-MHC remained at the same level up to day 16.
|
Because mRNA expression may not reflect protein expression, immunoblot analysis was performed with antibodies against sarcomeric myosin and
-actinin. As shown in Figure 4, treatment of ascorbic acid increased the expression of these proteins in a dose-dependent manner in untransfected ES cells. These results demonstrate that ascorbic acid induces cardiac differentiation in ES cells.
|
Effect of Antioxidants on Expression of MHCs
Because the effects of ascorbic acid are often attributed to its antioxidative properties, the effect of other antioxidants such as N-acetylcysteine, 4,5-dihydroxy-1,3-benzene-disulfonic acid (Tiron), and vitamin E on MHC expression was analyzed to assess the involvement of the antioxidative effect of ascorbic acid in the promotion of cardiac differentiation. Treatment with alternative antioxidative agents was unable to mimic the ascorbic acid effects on the expression of
-MHC and ß-MHC (Figure 5). These results suggest that the promoting effect of ascorbic acid on cardiac differentiation is independent of its antioxidative property.
|
| Discussion |
|---|
|
|
|---|
Because stable transfected clones have a transgene in their genome, and selected using G418, their characteristics may differ from wild-type ES cells. However, two clones of stable transfectants showed no difference in regard to differentiation. Furthermore, gene expression experiments in untransfected parental ES cells revealed that ascorbic acid markedly augmented the expression of cardiac markers, including GATA4, Nkx2.5,
-MHC, ß-MHC, and ANF, but not the noncardiac markers Tie-2 and ß-tubulin. These results show that treatment of ascorbic acid enhances cardiac differentiation of ES cells. ES cell-derived cardiomyocytes expressed cardiac genes in a developmentally controlled manner. In early myocardial development, GATA-4 and Nkx2.5 transcription factors appear before the expression of other cardiac genes. Kinetic PCR analysis revealed that cardiac differentiation induced by ascorbic acid recapitulated this developmental pattern, as GATA4 was detected earlier than cardiac MHCs. The expression of ß-MHC declined after peaking at day 10, whereas
-MHC expression remained stable up to day 16. This difference in expression pattern is consistent with the known ß to
transition in MHC isoform expression during ES cell differentiation through EB formation and murine cardiac development in vivo.7,11
Ascorbic acid is a water-soluble vitamin that acts as a cofactor in many biological reactions.12 The effects of ascorbic acid are often attributed to its antioxidative properties. In ES cell differentiation, however, it has been shown that antioxidants inhibit ES cell differentiation into cardiac myocytes, whereas H2O2 or radical-generating menadione enhances cardiogenesis.13 Further, our results, which show the inability of alternative antioxidative agents such as NAC, Tiron, and vitamin E to mimic the ascorbic acid effect on MHC expression, suggest that the effect of ascorbic acid on cardiac differentiation is independent of its antioxidative property, or that its antioxidative effect is insufficient to induce cardiac differentiation of ES cells. Ascorbic acid treatment has also been implicated in direct or indirect gene expression and can promote osteogenic differentiation in mesenchymal stem cells.12 When cardiac differentiation was induced through the formation of EBs, there was no significant effect of ascorbic acid on the differentiation into cardiac myocytes (data not shown). These results suggest that ascorbic acid induces permissive changes that occur during the formation of EBs, rather than induction of autonomous commitment of ES cells to cardiac myocytes. Further studies are needed to elucidate the mechanisms involved in this effect of ascorbic acid.
Our screen for compounds revealed that simple supplementation of ascorbic acid can enhance the yield of cardiac myocytes from ES cells, and this effect was not dependent on the scale of the culture, as a similar induction by ascorbic acid was seen on larger dishes (data not shown). This suggests that treatment of ES cells with ascorbic acid might facilitate the large-scale generation of cardiac myocytes, which is one of the major barriers for the possible use of ES cell-derived cardiac myocytes.
In conclusion, our data demonstrate that a screening system can be used to identify a chemical that induces cardiac differentiation of ES cells, and ascorbic acid markedly increases the efficiency of cardiac differentiation. These findings may contribute to efficient production of cardiac myocytes from ES cell culture for many applications and raise interesting questions about the role of ascorbic acid in cardiogenesis.
| Acknowledgments |
|---|
Received February 4, 2003; accepted February 19, 2003.
| References |
|---|
|
|
|---|
2. Hughes S. Cardiac stem cells. J Pathol. 2002; 197: 468478.[CrossRef][Medline] [Order article via Infotrieve]
3. Gepstein L. Derivation and potential applications of human embryonic stem cells. Circ Res. 2002; 91: 866876.
4. Sarang SS, Yoshida T, Cadet R, et al. Discovery of molecular mechanisms of neuroprotection using cell-based bioassays and oligonucleotide arrays. Physiol Genomics. 2002; 11: 4552.
5. Niwa H, Miyazaki J, Smith AG. Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat Genet. 2000; 24: 372376.[CrossRef][Medline] [Order article via Infotrieve]
6. Gulick J, Subramaniam A, Neumann J, et al. Isolation and characterization of the mouse cardiac myosin heavy chain genes. J Biol Chem. 1991; 266: 91809185.
7. Morkin E. Control of cardiac myosin heavy chain gene expression. Microsc Res Tech. 2000; 50: 522531.[CrossRef][Medline] [Order article via Infotrieve]
8. Fitzgerald RC, Omary MB, Triadafilopoulos G. Acid modulation of HT29 cell growth and differentiation: an in vitro model for Barretts esophagus. J Cell Sci. 1997; 110: 663671.[Abstract]
9. Yang H, Miller WM, Papoutsakis ET. Higher pH promotes megakaryocytic maturation and apoptosis. Stem Cells. 2002; 20: 320328.[CrossRef][Medline] [Order article via Infotrieve]
10. Czyz J, Wobus A. Embryonic stem cell differentiation: the role of extracellular factors. Differentiation. 2001; 68: 167174.[CrossRef][Medline] [Order article via Infotrieve]
11. Metzger JM, Lin WI, Johnston RA, et al. Myosin heavy chain expression in contracting myocytes isolated during embryonic stem cell cardiogenesis. Circ Res. 1995; 76: 710719.
12. Arrigoni O, De Tullio MC. Ascorbic acid: much more than just an antioxidant. Biochim Biophys Acta. 2002; 1569: 19.[Medline] [Order article via Infotrieve]
13. Sauer H, Rahimi G, Hescheler J, et al. Role of reactive oxygen species and phosphatidylinositol 3-kinase in cardiomyocyte differentiation of embryonic stem cells. FEBS Lett. 2000; 476: 218223.[CrossRef][Medline] [Order article via Infotrieve]
This article has been cited by other articles:
![]() |
P. J. Schlueter and R. T. Peterson Systematizing Serendipity for Cardiovascular Drug Discovery Circulation, July 21, 2009; 120(3): 255 - 263. [Full Text] [PDF] |
||||
![]() |
S. Takei, H. Ichikawa, K. Johkura, A. Mogi, H. No, S. Yoshie, D. Tomotsune, and K. Sasaki Bone morphogenetic protein-4 promotes induction of cardiomyocytes from human embryonic stem cells in serum-based embryoid body development Am J Physiol Heart Circ Physiol, June 1, 2009; 296(6): H1793 - H1803. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Guo and H.-T. Yang Ca2+ removal mechanisms in mouse embryonic stem cell-derived cardiomyocytes Am J Physiol Cell Physiol, January 1, 2009; 297(3): C732 - C741. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Raya, I. Rodriguez-Piza, B. Aran, A. Consiglio, P.N. Barri, A. Veiga, and J.C. Izpisua Belmonte Generation of Cardiomyocytes from New Human Embryonic Stem Cell Lines Derived from Poor-quality Blastocysts Cold Spring Harb Symp Quant Biol, November 26, 2008; (2008) sqb.2008.73.038v2. [Abstract] [PDF] |
||||
![]() |
K. Harada, A. Ogai, T. Takahashi, M. Kitakaze, H. Matsubara, and H. Oh Crossveinless-2 Controls Bone Morphogenetic Protein Signaling during Early Cardiomyocyte Differentiation in P19 Cells J. Biol. Chem., September 26, 2008; 283(39): 26705 - 26713. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Tokunou, R. Miller, P. Patwari, M. E. Davis, V. F. M. Segers, A. J. Grodzinsky, and R. T. Lee Engineering insulin-like growth factor-1 for local delivery FASEB J, June 1, 2008; 22(6): 1886 - 1893. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Sadek, B. Hannack, E. Choe, J. Wang, S. Latif, M. G. Garry, D. J. Garry, J. Longgood, D. E. Frantz, E. N. Olson, et al. Cardiogenic small molecules that enhance myocardial repair by stem cells PNAS, April 22, 2008; 105(16): 6063 - 6068. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Kitamura, T. Takahashi, N. Nakajima, K. Isodono, S. Asada, H. Ueno, T. Ueyama, T. Yoshikawa, H. Matsubara, and H. Oh Stage-Specific Role of Endogenous Smad2 Activation in Cardiomyogenesis of Embryonic Stem Cells Circ. Res., July 6, 2007; 101(1): 78 - 87. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Singh, F.-Q. Li, T. Hamazaki, H. Kasahara, K.-I. Takemaru, and N. Terada Chibby, an Antagonist of the Wnt/{beta}-Catenin Pathway, Facilitates Cardiomyocyte Differentiation of Murine Embryonic Stem Cells Circulation, February 6, 2007; 115(5): 617 - 626. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Zhou, P. D. Acton, and V. A. Ferrari Imaging Stem Cells Implanted in Infarcted Myocardium J. Am. Coll. Cardiol., November 21, 2006; 48(10): 2094 - 2106. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-M. Guo, Y.-S. Zhao, H.-X. Chang, C.-Y. Wang, L.-L. E, X.-A. Zhang, C.-M. Duan, L.-Z. Dong, H. Jiang, J. Li, et al. Creation of Engineered Cardiac Tissue In Vitro From Mouse Embryonic Stem Cells Circulation, May 9, 2006; 113(18): 2229 - 2237. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Fukuda and S. Yuasa Stem Cells as a Source of Regenerative Cardiomyocytes Circ. Res., April 28, 2006; 98(8): 1002 - 1013. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. P. Raikwar, T. Mueller, and N. Zavazava Strategies for Developing Therapeutic Application of Human Embryonic Stem Cells Physiology, February 1, 2006; 21(1): 19 - 28. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Hakuno, T. Takahashi, J. Lammerding, and R. T. Lee Focal Adhesion Kinase Signaling Regulates Cardiogenesis of Embryonic Stem Cells J. Biol. Chem., November 25, 2005; 280(47): 39534 - 39544. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Keller Embryonic stem cell differentiation: emergence of a new era in biology and medicine Genes & Dev., May 15, 2005; 19(10): 1129 - 1155. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. S. Ng, L. Azzola, K. Sourris, L. Robb, E. G. Stanley, and A. G. Elefanty The primitive streak gene Mixl1 is required for efficient haematopoiesis and BMP4-induced ventral mesoderm patterning in differentiating ES cells Development, March 1, 2005; 132(5): 873 - 884. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Davis, J.P. M. Motion, D. A. Narmoneva, T. Takahashi, D. Hakuno, R. D. Kamm, S. Zhang, and R. T. Lee Injectable Self-Assembling Peptide Nanofibers Create Intramyocardial Microenvironments for Endothelial Cells Circulation, February 1, 2005; 111(4): 442 - 450. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kanno, P. K. M. Kim, K. Sallam, J. Lei, T. R. Billiar, and L. L. Shears II Nitric oxide facilitates cardiomyogenesis in mouse embryonic stem cells PNAS, August 17, 2004; 101(33): 12277 - 12281. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2003 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |